ID: 1121833184

View in Genome Browser
Species Human (GRCh38)
Location 14:97069306-97069328
Sequence GTGTGACAACAGATGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121833180_1121833184 -1 Left 1121833180 14:97069284-97069306 CCTGGGAATTGAAAACAGAAATG No data
Right 1121833184 14:97069306-97069328 GTGTGACAACAGATGGACTGGGG No data
1121833179_1121833184 7 Left 1121833179 14:97069276-97069298 CCTGGGAGCCTGGGAATTGAAAA No data
Right 1121833184 14:97069306-97069328 GTGTGACAACAGATGGACTGGGG No data
1121833176_1121833184 22 Left 1121833176 14:97069261-97069283 CCAGAGGAATAGATTCCTGGGAG No data
Right 1121833184 14:97069306-97069328 GTGTGACAACAGATGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121833184 Original CRISPR GTGTGACAACAGATGGACTG GGG Intergenic
No off target data available for this crispr