ID: 1121835543

View in Genome Browser
Species Human (GRCh38)
Location 14:97088860-97088882
Sequence AGGCACAGAGGATGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121835536_1121835543 23 Left 1121835536 14:97088814-97088836 CCACAATTTAGTGAATTTATGAA No data
Right 1121835543 14:97088860-97088882 AGGCACAGAGGATGACCTGGAGG No data
1121835535_1121835543 27 Left 1121835535 14:97088810-97088832 CCATCCACAATTTAGTGAATTTA No data
Right 1121835543 14:97088860-97088882 AGGCACAGAGGATGACCTGGAGG No data
1121835534_1121835543 28 Left 1121835534 14:97088809-97088831 CCCATCCACAATTTAGTGAATTT No data
Right 1121835543 14:97088860-97088882 AGGCACAGAGGATGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121835543 Original CRISPR AGGCACAGAGGATGACCTGG AGG Intergenic