ID: 1121835545

View in Genome Browser
Species Human (GRCh38)
Location 14:97088867-97088889
Sequence GAGGATGACCTGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121835536_1121835545 30 Left 1121835536 14:97088814-97088836 CCACAATTTAGTGAATTTATGAA No data
Right 1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG No data
1121835541_1121835545 -7 Left 1121835541 14:97088851-97088873 CCAGGTGGCAGGCACAGAGGATG No data
Right 1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121835545 Original CRISPR GAGGATGACCTGGAGGAGGA AGG Intergenic
No off target data available for this crispr