ID: 1121837071

View in Genome Browser
Species Human (GRCh38)
Location 14:97101805-97101827
Sequence AGGTCACGGAACTACTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121837071_1121837077 -8 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837071_1121837078 -7 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837078 14:97101821-97101843 GTGACCTCAGATACAGGCTTGGG No data
1121837071_1121837084 28 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837084 14:97101856-97101878 CAGTTTCTCTATCTATAATAAGG No data
1121837071_1121837085 29 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121837071 Original CRISPR AGGTCACGGAACTACTGGGC GGG (reversed) Intergenic
No off target data available for this crispr