ID: 1121837077

View in Genome Browser
Species Human (GRCh38)
Location 14:97101820-97101842
Sequence CGTGACCTCAGATACAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121837070_1121837077 -7 Left 1121837070 14:97101804-97101826 CCCCGCCCAGTAGTTCCGTGACC No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837066_1121837077 12 Left 1121837066 14:97101785-97101807 CCCAGTCCTCCAGAGATTTCCCC No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837068_1121837077 6 Left 1121837068 14:97101791-97101813 CCTCCAGAGATTTCCCCGCCCAG No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837069_1121837077 3 Left 1121837069 14:97101794-97101816 CCAGAGATTTCCCCGCCCAGTAG No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837072_1121837077 -9 Left 1121837072 14:97101806-97101828 CCGCCCAGTAGTTCCGTGACCTC No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837071_1121837077 -8 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data
1121837067_1121837077 11 Left 1121837067 14:97101786-97101808 CCAGTCCTCCAGAGATTTCCCCG No data
Right 1121837077 14:97101820-97101842 CGTGACCTCAGATACAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121837077 Original CRISPR CGTGACCTCAGATACAGGCT TGG Intergenic
No off target data available for this crispr