ID: 1121837085

View in Genome Browser
Species Human (GRCh38)
Location 14:97101857-97101879
Sequence AGTTTCTCTATCTATAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121837072_1121837085 28 Left 1121837072 14:97101806-97101828 CCGCCCAGTAGTTCCGTGACCTC No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837071_1121837085 29 Left 1121837071 14:97101805-97101827 CCCGCCCAGTAGTTCCGTGACCT No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837073_1121837085 25 Left 1121837073 14:97101809-97101831 CCCAGTAGTTCCGTGACCTCAGA No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837079_1121837085 9 Left 1121837079 14:97101825-97101847 CCTCAGATACAGGCTTGGGCTCC No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837070_1121837085 30 Left 1121837070 14:97101804-97101826 CCCCGCCCAGTAGTTCCGTGACC No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837074_1121837085 24 Left 1121837074 14:97101810-97101832 CCAGTAGTTCCGTGACCTCAGAT No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data
1121837076_1121837085 15 Left 1121837076 14:97101819-97101841 CCGTGACCTCAGATACAGGCTTG No data
Right 1121837085 14:97101857-97101879 AGTTTCTCTATCTATAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121837085 Original CRISPR AGTTTCTCTATCTATAATAA GGG Intergenic
No off target data available for this crispr