ID: 1121845424

View in Genome Browser
Species Human (GRCh38)
Location 14:97168352-97168374
Sequence AGGGGGATCCCCTGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121845424_1121845432 14 Left 1121845424 14:97168352-97168374 CCTTCAGAGCAGGGGATCCCCCT No data
Right 1121845432 14:97168389-97168411 TCCCAGCACCTAGCAGAGGCTGG No data
1121845424_1121845436 25 Left 1121845424 14:97168352-97168374 CCTTCAGAGCAGGGGATCCCCCT No data
Right 1121845436 14:97168400-97168422 AGCAGAGGCTGGTACAGAGCAGG No data
1121845424_1121845431 10 Left 1121845424 14:97168352-97168374 CCTTCAGAGCAGGGGATCCCCCT No data
Right 1121845431 14:97168385-97168407 CATGTCCCAGCACCTAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121845424 Original CRISPR AGGGGGATCCCCTGCTCTGA AGG (reversed) Intergenic
No off target data available for this crispr