ID: 1121845701

View in Genome Browser
Species Human (GRCh38)
Location 14:97170230-97170252
Sequence AGTGGGGGATGCTGACCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121845701_1121845708 -2 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845708 14:97170251-97170273 CTGTCAGTCTGCAAAGGGTCAGG No data
1121845701_1121845711 24 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845701_1121845710 23 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845710 14:97170276-97170298 GCATTCCAAACAGGAGCTGCAGG No data
1121845701_1121845705 -7 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845705 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
1121845701_1121845709 14 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845709 14:97170267-97170289 GGTCAGGCTGCATTCCAAACAGG No data
1121845701_1121845703 -8 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845703 14:97170245-97170267 CCCCCACTGTCAGTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121845701 Original CRISPR AGTGGGGGATGCTGACCTAC TGG (reversed) Intergenic
No off target data available for this crispr