ID: 1121845704

View in Genome Browser
Species Human (GRCh38)
Location 14:97170246-97170268
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121845704_1121845714 27 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845714 14:97170296-97170318 AGGGCAGATTGGAAGAGCCCTGG No data
1121845704_1121845715 28 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845715 14:97170297-97170319 GGGCAGATTGGAAGAGCCCTGGG No data
1121845704_1121845709 -2 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845709 14:97170267-97170289 GGTCAGGCTGCATTCCAAACAGG No data
1121845704_1121845713 16 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845713 14:97170285-97170307 ACAGGAGCTGCAGGGCAGATTGG No data
1121845704_1121845710 7 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845710 14:97170276-97170298 GCATTCCAAACAGGAGCTGCAGG No data
1121845704_1121845711 8 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121845704 Original CRISPR CCCTTTGCAGACTGACAGTG GGG (reversed) Intergenic
No off target data available for this crispr