ID: 1121845711

View in Genome Browser
Species Human (GRCh38)
Location 14:97170277-97170299
Sequence CATTCCAAACAGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121845701_1121845711 24 Left 1121845701 14:97170230-97170252 CCAGTAGGTCAGCATCCCCCACT No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845702_1121845711 9 Left 1121845702 14:97170245-97170267 CCCCCACTGTCAGTCTGCAAAGG No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845704_1121845711 8 Left 1121845704 14:97170246-97170268 CCCCACTGTCAGTCTGCAAAGGG No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845700_1121845711 25 Left 1121845700 14:97170229-97170251 CCCAGTAGGTCAGCATCCCCCAC No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845707_1121845711 6 Left 1121845707 14:97170248-97170270 CCACTGTCAGTCTGCAAAGGGTC No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data
1121845706_1121845711 7 Left 1121845706 14:97170247-97170269 CCCACTGTCAGTCTGCAAAGGGT No data
Right 1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121845711 Original CRISPR CATTCCAAACAGGAGCTGCA GGG Intergenic
No off target data available for this crispr