ID: 1121849200

View in Genome Browser
Species Human (GRCh38)
Location 14:97204016-97204038
Sequence GGAGGGACAGGATTTCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121849200_1121849204 -10 Left 1121849200 14:97204016-97204038 CCTACCTGAAATCCTGTCCCTCC No data
Right 1121849204 14:97204029-97204051 CTGTCCCTCCAGGAATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121849200 Original CRISPR GGAGGGACAGGATTTCAGGT AGG (reversed) Intergenic
No off target data available for this crispr