ID: 1121851786

View in Genome Browser
Species Human (GRCh38)
Location 14:97228051-97228073
Sequence TCTGGGCACCAGACATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121851782_1121851786 -2 Left 1121851782 14:97228030-97228052 CCGTAAATTCTGTGTTTCCATTC No data
Right 1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG No data
1121851780_1121851786 23 Left 1121851780 14:97228005-97228027 CCAGGCTAGTGCTGGTCAGACTC No data
Right 1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG No data
1121851778_1121851786 25 Left 1121851778 14:97228003-97228025 CCCCAGGCTAGTGCTGGTCAGAC No data
Right 1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG No data
1121851781_1121851786 1 Left 1121851781 14:97228027-97228049 CCACCGTAAATTCTGTGTTTCCA No data
Right 1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG No data
1121851779_1121851786 24 Left 1121851779 14:97228004-97228026 CCCAGGCTAGTGCTGGTCAGACT No data
Right 1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121851786 Original CRISPR TCTGGGCACCAGACATATCA AGG Intergenic
No off target data available for this crispr