ID: 1121856047

View in Genome Browser
Species Human (GRCh38)
Location 14:97271036-97271058
Sequence CTTTATAAAGAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121856047_1121856051 2 Left 1121856047 14:97271036-97271058 CCATCCATCCTCTCTTTATAAAG No data
Right 1121856051 14:97271061-97271083 AGCAGGAAATATAAGAGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121856047 Original CRISPR CTTTATAAAGAGAGGATGGA TGG (reversed) Intergenic
No off target data available for this crispr