ID: 1121856091

View in Genome Browser
Species Human (GRCh38)
Location 14:97271443-97271465
Sequence ACCACGGATGGCCTCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121856091_1121856097 6 Left 1121856091 14:97271443-97271465 CCAAGTGTGAGGCCATCCGTGGT No data
Right 1121856097 14:97271472-97271494 CAAACAGCCATCCCCAGTTTTGG No data
1121856091_1121856098 7 Left 1121856091 14:97271443-97271465 CCAAGTGTGAGGCCATCCGTGGT No data
Right 1121856098 14:97271473-97271495 AAACAGCCATCCCCAGTTTTGGG No data
1121856091_1121856103 24 Left 1121856091 14:97271443-97271465 CCAAGTGTGAGGCCATCCGTGGT No data
Right 1121856103 14:97271490-97271512 TTTGGGCCTCTGTTCATGAATGG No data
1121856091_1121856104 25 Left 1121856091 14:97271443-97271465 CCAAGTGTGAGGCCATCCGTGGT No data
Right 1121856104 14:97271491-97271513 TTGGGCCTCTGTTCATGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121856091 Original CRISPR ACCACGGATGGCCTCACACT TGG (reversed) Intergenic
No off target data available for this crispr