ID: 1121856787

View in Genome Browser
Species Human (GRCh38)
Location 14:97277735-97277757
Sequence TGAGTGCTAAACATACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121856786_1121856787 20 Left 1121856786 14:97277692-97277714 CCTCTTTTTCACTACAGAACATC No data
Right 1121856787 14:97277735-97277757 TGAGTGCTAAACATACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121856787 Original CRISPR TGAGTGCTAAACATACAGCC AGG Intergenic
No off target data available for this crispr