ID: 1121856932

View in Genome Browser
Species Human (GRCh38)
Location 14:97278770-97278792
Sequence GAGGCACATTAGCATGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121856932_1121856934 -7 Left 1121856932 14:97278770-97278792 CCTTTAACATGCTAATGTGCCTC No data
Right 1121856934 14:97278786-97278808 GTGCCTCATAGGTTGCAAGAAGG No data
1121856932_1121856936 26 Left 1121856932 14:97278770-97278792 CCTTTAACATGCTAATGTGCCTC No data
Right 1121856936 14:97278819-97278841 TAGCATGACCAAAATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121856932 Original CRISPR GAGGCACATTAGCATGTTAA AGG (reversed) Intergenic