ID: 1121856936

View in Genome Browser
Species Human (GRCh38)
Location 14:97278819-97278841
Sequence TAGCATGACCAAAATCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121856935_1121856936 7 Left 1121856935 14:97278789-97278811 CCTCATAGGTTGCAAGAAGGAGT No data
Right 1121856936 14:97278819-97278841 TAGCATGACCAAAATCCACTTGG No data
1121856932_1121856936 26 Left 1121856932 14:97278770-97278792 CCTTTAACATGCTAATGTGCCTC No data
Right 1121856936 14:97278819-97278841 TAGCATGACCAAAATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121856936 Original CRISPR TAGCATGACCAAAATCCACT TGG Intergenic