ID: 1121857495

View in Genome Browser
Species Human (GRCh38)
Location 14:97283528-97283550
Sequence GCTTATCCACGGGTGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121857495_1121857499 -6 Left 1121857495 14:97283528-97283550 CCAAATCTCACCCGTGGATAAGC No data
Right 1121857499 14:97283545-97283567 ATAAGCCACTTCCGGTAGCTTGG No data
1121857495_1121857502 17 Left 1121857495 14:97283528-97283550 CCAAATCTCACCCGTGGATAAGC No data
Right 1121857502 14:97283568-97283590 TGAAGAAGCACGTAAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121857495 Original CRISPR GCTTATCCACGGGTGAGATT TGG (reversed) Intergenic
No off target data available for this crispr