ID: 1121860459

View in Genome Browser
Species Human (GRCh38)
Location 14:97312975-97312997
Sequence TGCCCTGAGCTCTTACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121860459_1121860466 12 Left 1121860459 14:97312975-97312997 CCTCAATGTAAGAGCTCAGGGCA No data
Right 1121860466 14:97313010-97313032 AGGGGCCTTTCAGTAACATATGG No data
1121860459_1121860462 -7 Left 1121860459 14:97312975-97312997 CCTCAATGTAAGAGCTCAGGGCA No data
Right 1121860462 14:97312991-97313013 CAGGGCAAAGGCCAAATCCAGGG No data
1121860459_1121860463 -6 Left 1121860459 14:97312975-97312997 CCTCAATGTAAGAGCTCAGGGCA No data
Right 1121860463 14:97312992-97313014 AGGGCAAAGGCCAAATCCAGGGG No data
1121860459_1121860461 -8 Left 1121860459 14:97312975-97312997 CCTCAATGTAAGAGCTCAGGGCA No data
Right 1121860461 14:97312990-97313012 TCAGGGCAAAGGCCAAATCCAGG No data
1121860459_1121860468 20 Left 1121860459 14:97312975-97312997 CCTCAATGTAAGAGCTCAGGGCA No data
Right 1121860468 14:97313018-97313040 TTCAGTAACATATGGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121860459 Original CRISPR TGCCCTGAGCTCTTACATTG AGG (reversed) Intergenic
No off target data available for this crispr