ID: 1121861669

View in Genome Browser
Species Human (GRCh38)
Location 14:97324433-97324455
Sequence CTGAATCAGCAGAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121861669_1121861671 -1 Left 1121861669 14:97324433-97324455 CCTTCCTGTTTCTGCTGATTCAG No data
Right 1121861671 14:97324455-97324477 GACATGCTCTGTCCTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121861669 Original CRISPR CTGAATCAGCAGAAACAGGA AGG (reversed) Intergenic
No off target data available for this crispr