ID: 1121862861

View in Genome Browser
Species Human (GRCh38)
Location 14:97336005-97336027
Sequence GCATCCTTCTGTCCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121862861_1121862865 -4 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862865 14:97336024-97336046 ATGCTCTCCCGGAGGTCCAGAGG No data
1121862861_1121862867 -2 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862867 14:97336026-97336048 GCTCTCCCGGAGGTCCAGAGGGG No data
1121862861_1121862866 -3 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862866 14:97336025-97336047 TGCTCTCCCGGAGGTCCAGAGGG No data
1121862861_1121862878 21 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862878 14:97336049-97336071 ACCCTGGAAGAGGTGGGAGGGGG No data
1121862861_1121862876 19 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862876 14:97336047-97336069 GGACCCTGGAAGAGGTGGGAGGG No data
1121862861_1121862881 27 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862881 14:97336055-97336077 GAAGAGGTGGGAGGGGGACCAGG No data
1121862861_1121862877 20 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862877 14:97336048-97336070 GACCCTGGAAGAGGTGGGAGGGG No data
1121862861_1121862875 18 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862875 14:97336046-97336068 GGGACCCTGGAAGAGGTGGGAGG No data
1121862861_1121862874 15 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862874 14:97336043-97336065 GAGGGGACCCTGGAAGAGGTGGG No data
1121862861_1121862873 14 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862873 14:97336042-97336064 AGAGGGGACCCTGGAAGAGGTGG No data
1121862861_1121862871 11 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862871 14:97336039-97336061 TCCAGAGGGGACCCTGGAAGAGG No data
1121862861_1121862870 5 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862870 14:97336033-97336055 CGGAGGTCCAGAGGGGACCCTGG No data
1121862861_1121862882 28 Left 1121862861 14:97336005-97336027 CCAGGACCAGGACAGAAGGATGC No data
Right 1121862882 14:97336056-97336078 AAGAGGTGGGAGGGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121862861 Original CRISPR GCATCCTTCTGTCCTGGTCC TGG (reversed) Intergenic
No off target data available for this crispr