ID: 1121866492

View in Genome Browser
Species Human (GRCh38)
Location 14:97367149-97367171
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121866485_1121866492 27 Left 1121866485 14:97367099-97367121 CCGTCTCTCAGAATTGGTCTTCC No data
Right 1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG No data
1121866487_1121866492 6 Left 1121866487 14:97367120-97367142 CCAGAGCAGGCTTTGCTGCCTAA No data
Right 1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121866492 Original CRISPR CCCTCCACACAGGCTGCAGA AGG Intergenic