ID: 1121873404

View in Genome Browser
Species Human (GRCh38)
Location 14:97429925-97429947
Sequence TGGGAAGTATGGCCATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121873404_1121873414 23 Left 1121873404 14:97429925-97429947 CCTCCCAATGGCCATACTTCCCA No data
Right 1121873414 14:97429971-97429993 TTGCAGCATGAATTTGGCAGGGG No data
1121873404_1121873413 22 Left 1121873404 14:97429925-97429947 CCTCCCAATGGCCATACTTCCCA No data
Right 1121873413 14:97429970-97429992 GTTGCAGCATGAATTTGGCAGGG No data
1121873404_1121873412 21 Left 1121873404 14:97429925-97429947 CCTCCCAATGGCCATACTTCCCA No data
Right 1121873412 14:97429969-97429991 AGTTGCAGCATGAATTTGGCAGG No data
1121873404_1121873408 -8 Left 1121873404 14:97429925-97429947 CCTCCCAATGGCCATACTTCCCA No data
Right 1121873408 14:97429940-97429962 ACTTCCCAATATTGTTGCATTGG No data
1121873404_1121873411 17 Left 1121873404 14:97429925-97429947 CCTCCCAATGGCCATACTTCCCA No data
Right 1121873411 14:97429965-97429987 ATTAAGTTGCAGCATGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121873404 Original CRISPR TGGGAAGTATGGCCATTGGG AGG (reversed) Intergenic
No off target data available for this crispr