ID: 1121877191

View in Genome Browser
Species Human (GRCh38)
Location 14:97464214-97464236
Sequence CAATTTTCCTAGGGTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121877191_1121877203 26 Left 1121877191 14:97464214-97464236 CCTGCTGCACCCTAGGAAAATTG No data
Right 1121877203 14:97464263-97464285 CAACCCCAGAGCTAGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121877191 Original CRISPR CAATTTTCCTAGGGTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr