ID: 1121879113

View in Genome Browser
Species Human (GRCh38)
Location 14:97484183-97484205
Sequence CCTTCCAAAGTAGAGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121879113_1121879117 7 Left 1121879113 14:97484183-97484205 CCACCAAACTCTACTTTGGAAGG No data
Right 1121879117 14:97484213-97484235 TCACTGCTTGCCTCTTTTCCTGG No data
1121879113_1121879118 16 Left 1121879113 14:97484183-97484205 CCACCAAACTCTACTTTGGAAGG No data
Right 1121879118 14:97484222-97484244 GCCTCTTTTCCTGGTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121879113 Original CRISPR CCTTCCAAAGTAGAGTTTGG TGG (reversed) Intergenic
No off target data available for this crispr