ID: 1121887757

View in Genome Browser
Species Human (GRCh38)
Location 14:97560402-97560424
Sequence CAGGACATGGAGATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121887752_1121887757 12 Left 1121887752 14:97560367-97560389 CCAAACAGTTCCAGGATCACTAA No data
Right 1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG No data
1121887754_1121887757 2 Left 1121887754 14:97560377-97560399 CCAGGATCACTAAGGAATCAGAG No data
Right 1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121887757 Original CRISPR CAGGACATGGAGATGAAGCC TGG Intergenic
No off target data available for this crispr