ID: 1121888796

View in Genome Browser
Species Human (GRCh38)
Location 14:97570268-97570290
Sequence GTGGAATCTCGCACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121888796_1121888803 8 Left 1121888796 14:97570268-97570290 CCCTCCTCTGTGCGAGATTCCAC No data
Right 1121888803 14:97570299-97570321 GTTGAATATATGAGTCTTGGAGG No data
1121888796_1121888805 30 Left 1121888796 14:97570268-97570290 CCCTCCTCTGTGCGAGATTCCAC No data
Right 1121888805 14:97570321-97570343 GAGCATCCAACCTGCAGAAAGGG No data
1121888796_1121888802 5 Left 1121888796 14:97570268-97570290 CCCTCCTCTGTGCGAGATTCCAC No data
Right 1121888802 14:97570296-97570318 AAAGTTGAATATATGAGTCTTGG No data
1121888796_1121888804 29 Left 1121888796 14:97570268-97570290 CCCTCCTCTGTGCGAGATTCCAC No data
Right 1121888804 14:97570320-97570342 GGAGCATCCAACCTGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121888796 Original CRISPR GTGGAATCTCGCACAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr