ID: 1121891646

View in Genome Browser
Species Human (GRCh38)
Location 14:97598962-97598984
Sequence CTGGGCCTGGACTGTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121891646_1121891648 -7 Left 1121891646 14:97598962-97598984 CCTACAAAACAGTCCAGGCCCAG No data
Right 1121891648 14:97598978-97599000 GGCCCAGTGACCTCACTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121891646 Original CRISPR CTGGGCCTGGACTGTTTTGT AGG (reversed) Intergenic
No off target data available for this crispr