ID: 1121893546

View in Genome Browser
Species Human (GRCh38)
Location 14:97622420-97622442
Sequence GTCCTCTTTGGACCCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121893541_1121893546 11 Left 1121893541 14:97622386-97622408 CCTATTTTCCACCCAGATTAGAA No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893538_1121893546 18 Left 1121893538 14:97622379-97622401 CCCCAATCCTATTTTCCACCCAG No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893540_1121893546 16 Left 1121893540 14:97622381-97622403 CCAATCCTATTTTCCACCCAGAT No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893542_1121893546 3 Left 1121893542 14:97622394-97622416 CCACCCAGATTAGAAAGCTATCA No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893539_1121893546 17 Left 1121893539 14:97622380-97622402 CCCAATCCTATTTTCCACCCAGA No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893543_1121893546 0 Left 1121893543 14:97622397-97622419 CCCAGATTAGAAAGCTATCATGA No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data
1121893544_1121893546 -1 Left 1121893544 14:97622398-97622420 CCAGATTAGAAAGCTATCATGAG No data
Right 1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121893546 Original CRISPR GTCCTCTTTGGACCCCAATC AGG Intergenic
No off target data available for this crispr