ID: 1121894379

View in Genome Browser
Species Human (GRCh38)
Location 14:97632148-97632170
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121894379_1121894380 11 Left 1121894379 14:97632148-97632170 CCGGCAATCTTATGCAGTAAACT No data
Right 1121894380 14:97632182-97632204 TGTTTTAGTGAAGTGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121894379 Original CRISPR AGTTTACTGCATAAGATTGC CGG (reversed) Intergenic
No off target data available for this crispr