ID: 1121896932

View in Genome Browser
Species Human (GRCh38)
Location 14:97657454-97657476
Sequence AGAAGGGGTCTGCACAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121896924_1121896932 8 Left 1121896924 14:97657423-97657445 CCAGGAGAACAGCCTTGCTAACA No data
Right 1121896932 14:97657454-97657476 AGAAGGGGTCTGCACAACCTTGG No data
1121896923_1121896932 23 Left 1121896923 14:97657408-97657430 CCAGGTCAGGCTAGACCAGGAGA No data
Right 1121896932 14:97657454-97657476 AGAAGGGGTCTGCACAACCTTGG No data
1121896928_1121896932 -4 Left 1121896928 14:97657435-97657457 CCTTGCTAACAGTAGGGGAAGAA No data
Right 1121896932 14:97657454-97657476 AGAAGGGGTCTGCACAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121896932 Original CRISPR AGAAGGGGTCTGCACAACCT TGG Intergenic
No off target data available for this crispr