ID: 1121897393

View in Genome Browser
Species Human (GRCh38)
Location 14:97661251-97661273
Sequence TCATGAAGCATTTATGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121897389_1121897393 22 Left 1121897389 14:97661206-97661228 CCTTAGTTCTGACATGTGGGGCA No data
Right 1121897393 14:97661251-97661273 TCATGAAGCATTTATGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121897393 Original CRISPR TCATGAAGCATTTATGCTTT TGG Intergenic
No off target data available for this crispr