ID: 1121904118

View in Genome Browser
Species Human (GRCh38)
Location 14:97724060-97724082
Sequence ATGTAGCCACAGCTCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121904118_1121904129 27 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904129 14:97724110-97724132 GGCCCAGAGGTCATTGAATGTGG No data
1121904118_1121904122 -4 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904122 14:97724079-97724101 ACATCTGCCTGTGGGTGTCCTGG No data
1121904118_1121904127 14 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904127 14:97724097-97724119 CCTGGACTCCATGGGCCCAGAGG No data
1121904118_1121904124 5 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904124 14:97724088-97724110 TGTGGGTGTCCTGGACTCCATGG No data
1121904118_1121904132 30 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904132 14:97724113-97724135 CCAGAGGTCATTGAATGTGGCGG No data
1121904118_1121904125 6 Left 1121904118 14:97724060-97724082 CCTTCCTCGAGCTGTGGCTACAT No data
Right 1121904125 14:97724089-97724111 GTGGGTGTCCTGGACTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121904118 Original CRISPR ATGTAGCCACAGCTCGAGGA AGG (reversed) Intergenic
No off target data available for this crispr