ID: 1121904309

View in Genome Browser
Species Human (GRCh38)
Location 14:97725627-97725649
Sequence CAGCATGATTAGATGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121904306_1121904309 17 Left 1121904306 14:97725587-97725609 CCTGATGAAAATTAAAGTTCAGA No data
Right 1121904309 14:97725627-97725649 CAGCATGATTAGATGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121904309 Original CRISPR CAGCATGATTAGATGCTACC TGG Intergenic
No off target data available for this crispr