ID: 1121906277

View in Genome Browser
Species Human (GRCh38)
Location 14:97749307-97749329
Sequence CTTAACATGATGCATATAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121906277_1121906282 8 Left 1121906277 14:97749307-97749329 CCTATTATATGCATCATGTTAAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1121906282 14:97749338-97749360 TTAGAGGAAAGTTAAATTGCAGG 0: 1
1: 0
2: 2
3: 20
4: 208
1121906277_1121906279 -8 Left 1121906277 14:97749307-97749329 CCTATTATATGCATCATGTTAAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1121906279 14:97749322-97749344 ATGTTAAGGTCCCATGTTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121906277 Original CRISPR CTTAACATGATGCATATAAT AGG (reversed) Exonic
909694601 1:78452395-78452417 CGTTACATGATTCCTATAATGGG - Intronic
910142312 1:84039140-84039162 CTTAACATGTCCCAGATAATTGG - Intergenic
910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG + Exonic
911760847 1:101614232-101614254 CTTAAATTGATGTATATATTTGG - Intergenic
912425674 1:109587723-109587745 CCTACCATGATCCATATCATGGG + Intronic
914886576 1:151590005-151590027 CTCAATATCATGCAAATAATAGG - Intergenic
917474179 1:175354157-175354179 CTTTACTTGGTGCATTTAATTGG + Intronic
918111059 1:181455913-181455935 CTCAACAGGATGCATTTACTGGG + Intronic
918932031 1:190866045-190866067 CATAACATTATACATATACTTGG - Intergenic
920427951 1:205893434-205893456 CAACATATGATGCATATAATGGG + Intergenic
922866820 1:228867604-228867626 CATAACATGGACCATATAATTGG - Intergenic
1067183828 10:44010630-44010652 CTTAACATGATGTATATTTTGGG + Intergenic
1067214583 10:44292142-44292164 CTTAACAGGGTGCTTAGAATGGG + Intergenic
1068144430 10:53049185-53049207 CTTAATAACATGCATGTAATAGG - Intergenic
1068482787 10:57615297-57615319 GTTTACATGTTGCATAAAATGGG - Intergenic
1069102273 10:64336740-64336762 CGCAACATGATGGATATCATGGG - Intergenic
1071206533 10:83285960-83285982 CTTACAAGGATGCATATATTTGG + Intergenic
1074333226 10:112541543-112541565 ATTAACTTGATGAATGTAATTGG + Intronic
1077427209 11:2487516-2487538 CTTAAAAAGATGCAAATAAATGG - Intronic
1078731684 11:13980783-13980805 TATAACATGATGAATATATTCGG + Intronic
1079889904 11:26038762-26038784 CTTCATAAGAGGCATATAATAGG + Intergenic
1085857339 11:80190074-80190096 GTTAACCTGATACATATAAAGGG - Intergenic
1086221937 11:84456218-84456240 CTTGTCATGATTCATATCATGGG - Intronic
1088199258 11:107313308-107313330 ATTGACATGATGGATAGAATTGG - Intergenic
1089990483 11:122854734-122854756 TTTAACATAATACATATAATTGG + Intronic
1092576829 12:9793542-9793564 ATTAAATTGATGCATAAAATAGG + Intergenic
1094367728 12:29701807-29701829 ATTGACATGATGAATTTAATTGG - Intronic
1095152475 12:38811897-38811919 CCTAACATAATGCCTATAAAAGG - Intronic
1095336681 12:41037036-41037058 CTTAACATGAAACATAGAAAGGG - Intronic
1096154110 12:49332373-49332395 CTTAACTTGGTGCATAGACTGGG - Intergenic
1097765182 12:63518280-63518302 CTTCAAATGATGTATGTAATGGG - Intergenic
1098654548 12:73011578-73011600 ATTAACATGATTAATAGAATAGG - Intergenic
1101037470 12:100719241-100719263 CCTAAAATGATGCATATACTTGG + Intronic
1102972150 12:117177728-117177750 CTTAACAAGAAAAATATAATTGG + Intronic
1104431022 12:128716314-128716336 CTTTGAATGAGGCATATAATTGG + Intergenic
1105596523 13:21844378-21844400 CTGAACATCATGAATATACTTGG + Intergenic
1108007684 13:45968219-45968241 CTTAAAATGATTTATATATTTGG - Intronic
1109158906 13:58948016-58948038 CTTAATATGATTAATATACTTGG + Intergenic
1109442727 13:62396130-62396152 CTTAACTTTATGCATATCATTGG + Intergenic
1109454725 13:62569981-62570003 CTTCAGAACATGCATATAATAGG - Intergenic
1110959053 13:81597542-81597564 GTCAGCATGATGCATACAATGGG - Intergenic
1111094804 13:83499341-83499363 CTAAACTGGATGGATATAATGGG + Intergenic
1114955996 14:27820095-27820117 CTTATCATGATAAATAAAATAGG - Intergenic
1115849275 14:37575994-37576016 CTTAACATTAAGCACAAAATAGG + Intergenic
1116118384 14:40688620-40688642 CTTTACTTCATGCATAAAATGGG + Intergenic
1118426752 14:65673038-65673060 CTTAATATGATAAATGTAATTGG + Intronic
1118502221 14:66372465-66372487 TTTAACAAGATGCATATAGATGG + Intergenic
1121906277 14:97749307-97749329 CTTAACATGATGCATATAATAGG - Exonic
1124986913 15:34627755-34627777 TTGAAAATGATGCCTATAATTGG + Intergenic
1125193150 15:37016643-37016665 CCTACTATTATGCATATAATAGG + Intronic
1127882894 15:63173889-63173911 TTTACAATGATGCAGATAATTGG + Intergenic
1129279325 15:74471583-74471605 CATAATATCTTGCATATAATAGG - Intergenic
1130831344 15:87604184-87604206 CTTACCAGCATGCATTTAATGGG + Intergenic
1135670631 16:24372529-24372551 CTTACAATGATGCAGAAAATGGG + Intergenic
1135842040 16:25885785-25885807 CTTTACATTATGAATATAAATGG + Intronic
1137935056 16:52627026-52627048 GTTCACATGATGCATAAAAATGG + Intergenic
1139501219 16:67367624-67367646 TTTAACATGATATATATATTAGG + Intronic
1141185962 16:81787598-81787620 CTATACATGCTGCATACAATGGG - Intronic
1149092331 17:52798698-52798720 GTTAACTTGTTGCATATAAAGGG + Intergenic
1154245955 18:12698707-12698729 CATAACACTATGCACATAATAGG + Intronic
1156786044 18:40916600-40916622 CTAAACATGTTTCAGATAATAGG - Intergenic
1158502269 18:58013375-58013397 CATGACATGATGCATTGAATGGG + Intergenic
1158916728 18:62139677-62139699 CCTAACATGCTGTATATAATGGG - Intronic
1159424732 18:68270874-68270896 CTTCCCCTGATGTATATAATTGG + Intergenic
1159489265 18:69108938-69108960 TTTAACATGGTTCATAAAATAGG - Intergenic
1167974599 19:53214723-53214745 CATAACATGATGTATATCAAAGG + Intergenic
925717013 2:6793511-6793533 CTTAAGGTGATGCAATTAATAGG - Intergenic
925876933 2:8319453-8319475 ATCAACATGATGCATAAATTGGG + Intergenic
926372872 2:12198193-12198215 TTTAACATGATGGATACCATTGG + Intergenic
927636723 2:24822013-24822035 TTTAACCTCATCCATATAATAGG + Exonic
928807929 2:35184076-35184098 TTTAACATGATTCAAATCATGGG - Intergenic
928828693 2:35452077-35452099 CTTAACATATTTCATATAAGTGG + Intergenic
930383799 2:50665872-50665894 CTTAAGAAGATGCTTATAAAAGG - Intronic
930630475 2:53748118-53748140 TTTTACATGAAGCAGATAATTGG - Intronic
933594813 2:84272731-84272753 CCTAATATGTTGCACATAATGGG + Intergenic
934481286 2:94648029-94648051 CTTATCATGATAAATAAAATAGG + Intergenic
936758273 2:115740812-115740834 CTTTACATGATTAATATACTGGG - Intronic
939695847 2:145323371-145323393 TTTAACATGATGAGGATAATAGG + Intergenic
941670837 2:168290762-168290784 TTTAACATGAGGCCTGTAATAGG - Intergenic
943013196 2:182477230-182477252 CTCAACATGAGTCAGATAATTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1177117317 21:17102096-17102118 CTGGACATGATGAATAAAATAGG + Intergenic
1177282779 21:19005800-19005822 CCTAAAATCATGGATATAATTGG + Intergenic
1177649314 21:23940069-23940091 CTTAAACTGATGCATATAGGGGG + Intergenic
1183024092 22:35050721-35050743 CTTAACATTAGGCATCTTATGGG - Intergenic
1184967844 22:47994459-47994481 CTCATCATGCTGCATATAGTAGG + Intergenic
950560627 3:13719565-13719587 CTTAAAATGATGCAGCTAGTTGG + Intergenic
951878201 3:27452549-27452571 TTTCAAAGGATGCATATAATAGG - Intronic
951965372 3:28377782-28377804 CTTAATATGCTGAATAAAATTGG + Intronic
952389462 3:32867283-32867305 ATTTACATAATACATATAATGGG + Intronic
954460441 3:50623657-50623679 CTGAACCTCATCCATATAATGGG - Intronic
957435290 3:80167513-80167535 ATTAAAATGATGCATACAAAGGG - Intergenic
960453450 3:117840037-117840059 CATAACAAGATTCATACAATAGG - Intergenic
960932415 3:122866936-122866958 CTTAACACTGTGCATATAAATGG + Intronic
962112361 3:132466553-132466575 CTTAAAAAGATGAATATTATGGG - Intronic
965259630 3:166465310-166465332 CCAAACATAATGGATATAATAGG - Intergenic
965269479 3:166595234-166595256 CTTAAAATAGTGAATATAATTGG - Intergenic
965610596 3:170539673-170539695 CTTAACTTAATGAATATAAGAGG - Intronic
972091923 4:35297411-35297433 AGTAAAATTATGCATATAATTGG + Intergenic
975161251 4:71127100-71127122 GTTAGCATGATGGATATAAGTGG - Intergenic
975254879 4:72221698-72221720 AATAAAAAGATGCATATAATTGG - Intergenic
976176666 4:82361000-82361022 CTGAACATTAAGCATATAAATGG - Intronic
977087460 4:92620667-92620689 CATAACACTTTGCATATAATAGG + Intronic
978511614 4:109526377-109526399 CTTTGCTTGATGTATATAATAGG - Exonic
978865052 4:113497214-113497236 CATAACAAGATTCATATAAAGGG + Intronic
979541376 4:121887416-121887438 CCTAACATCATGTATATAACAGG + Intronic
980050093 4:128030869-128030891 CTAAGCATGATGCATATTATAGG + Exonic
980241194 4:130178141-130178163 CTGAAGATGATGCATAAAAAGGG - Intergenic
981860539 4:149350682-149350704 CTTAACATGATTCTTGTAATTGG + Intergenic
982498445 4:156122158-156122180 CTTAAAATGAGGCATACAAATGG + Intergenic
983163087 4:164441471-164441493 CTTACCAGGATGAATATGATGGG + Intergenic
984874405 4:184354569-184354591 GTTAACATAATGTCTATAATCGG - Intergenic
987426819 5:17782523-17782545 ATTAACATGAAACATTTAATTGG + Intergenic
988419018 5:30983011-30983033 CTTAACTTGATGAATGTAACTGG - Intergenic
990624259 5:57593903-57593925 CTTCACAGGCTGCACATAATAGG - Intergenic
996390400 5:122954411-122954433 CTTATCATTATTGATATAATTGG + Intronic
999163753 5:149529711-149529733 CTTTACATGCTGTAAATAATTGG + Intronic
999908786 5:156172859-156172881 TTTAACTTGATACATATTATTGG + Intronic
1001425635 5:171620421-171620443 GTTAGTATGATGCATATCATTGG - Intergenic
1008399515 6:51048512-51048534 CATTACATGATTGATATAATAGG - Intergenic
1008790591 6:55227187-55227209 CTTAACATAATGCATAATTTTGG - Intronic
1011274019 6:85610808-85610830 TCTAACATAATGAATATAATAGG - Intronic
1011342674 6:86334567-86334589 TATAACATGATGCTTTTAATTGG + Intergenic
1011415352 6:87113370-87113392 CTTAAAATGCTGCATGTAATTGG + Intergenic
1012054697 6:94391640-94391662 CTTCACTTGAGGCACATAATGGG - Intergenic
1015037487 6:128674110-128674132 CTTAACAAAACACATATAATAGG + Intergenic
1015314469 6:131803040-131803062 CTGAACTGTATGCATATAATGGG + Intergenic
1015495591 6:133879734-133879756 ATTGAGATGATGCATATAAAGGG - Intergenic
1017261867 6:152397099-152397121 GTAAAAATGATGCATACAATTGG + Intronic
1018567441 6:165169572-165169594 ATTAACAGGATGGATATAGTGGG + Intergenic
1020258222 7:6514571-6514593 CTTACCATGATGCACAGAGTGGG + Intronic
1022397492 7:30002785-30002807 CTTTAAATTATCCATATAATTGG - Intergenic
1024761982 7:52609744-52609766 CTTAACAAGTTGCATGTCATTGG - Intergenic
1026394825 7:69940817-69940839 CTTATTAGGATGCAGATAATAGG + Intronic
1026813139 7:73486104-73486126 CATAGTATGTTGCATATAATAGG - Intronic
1028607971 7:92676396-92676418 TTTAAAATGATGTATATACTTGG + Intronic
1030223847 7:107126980-107127002 CTTTACATAATGCAAATAAATGG + Intronic
1031465240 7:122101961-122101983 CTTAATATGATACATTTAACTGG - Intronic
1033854302 7:145538817-145538839 GATAACATGATGCATGTCATAGG - Intergenic
1035624988 8:1064729-1064751 CTTAAAATGTTATATATAATTGG - Intergenic
1038070087 8:24004156-24004178 CTTAACATCAAGCAGAAAATAGG + Intergenic
1039226844 8:35397564-35397586 CTTAACATCATGCATTGAGTAGG + Intronic
1039240101 8:35547049-35547071 CTTAAGCTGATGTATTTAATGGG + Intronic
1039958523 8:42225971-42225993 CATAATATGATGCATTTTATTGG - Intergenic
1042571419 8:70169467-70169489 CTGCACATGAAGCATATTATAGG - Intronic
1043155091 8:76768878-76768900 CTTATCTTGATACATAAAATAGG - Intronic
1043654797 8:82649507-82649529 CTTAAAATAAGGCATATAAATGG + Intergenic
1046417032 8:113930666-113930688 CTTTAAATTATGCATATATTGGG + Intergenic
1046789048 8:118300909-118300931 TTTAACATGATGCATAAAGATGG + Intronic
1050287658 9:4119273-4119295 CATAACATGCTGCACATAGTAGG - Intronic
1051813915 9:21081944-21081966 CTTAAAATGATGTATTTAAAAGG - Intergenic
1053676551 9:40436076-40436098 CTTATCATGATAAATAAAATAGG - Intergenic
1053926320 9:43062188-43062210 CTTATCATGATAAATAAAATAGG - Intergenic
1054289620 9:63271594-63271616 CTTATCATGATAAATAAAATAGG - Intergenic
1054387648 9:64576144-64576166 CTTATCATGATAAATAAAATAGG - Intergenic
1054508070 9:65940218-65940240 CTTATCATGATAAATAAAATAGG + Intergenic
1057209615 9:93192667-93192689 CAAAACATGATTCATACAATGGG + Intronic
1060316095 9:122511853-122511875 GTTAACATGTTGAATGTAATTGG + Intergenic
1187656975 X:21487235-21487257 CTTAATATGATGAATTTAATTGG + Intronic
1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG + Intergenic
1187765143 X:22633118-22633140 GTTAACACGATGCAAATATTAGG + Intergenic
1187906833 X:24074723-24074745 CATAACATGTTGAATAAAATAGG - Intronic
1188327203 X:28820373-28820395 CTTAACGGTATGCATCTAATTGG + Intronic
1190700246 X:52982731-52982753 CTGAACATGATGTGTATTATTGG - Intronic
1192283507 X:69708923-69708945 GATAACATCATGCAGATAATTGG + Intronic
1193280530 X:79643327-79643349 CCTAACATGATGCAACTAACAGG - Intergenic
1193375830 X:80759750-80759772 CTCAACATGATAGCTATAATTGG + Intronic
1196468538 X:115997685-115997707 CTTAACAATATGCATATTTTTGG + Intergenic
1198636457 X:138706900-138706922 CATAACCTGATGCATACAAATGG - Intronic
1199403708 X:147430606-147430628 CACAACATCTTGCATATAATAGG - Intergenic