ID: 1121907500

View in Genome Browser
Species Human (GRCh38)
Location 14:97760268-97760290
Sequence TTTAATATACATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121907496_1121907500 26 Left 1121907496 14:97760219-97760241 CCAGTAATCACTGTGTATTGCAT 0: 1
1: 0
2: 0
3: 7
4: 221
Right 1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 283
1121907495_1121907500 27 Left 1121907495 14:97760218-97760240 CCCAGTAATCACTGTGTATTGCA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 283
1121907494_1121907500 30 Left 1121907494 14:97760215-97760237 CCTCCCAGTAATCACTGTGTATT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121907500 Original CRISPR TTTAATATACATGAGGAGGA GGG Intronic
901911876 1:12465419-12465441 TTTAAGTTAGATAAGGAGGAAGG + Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
907654428 1:56327703-56327725 TTTATTGTACATGAAGAAGAAGG + Intergenic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
914769291 1:150669663-150669685 TTTAATATACATCTGTAGGCCGG + Intronic
914979467 1:152400043-152400065 TTTATTTTACTTGAGGATGATGG - Intergenic
915966470 1:160313219-160313241 TTTAATATTCTTGTGTAGGATGG - Intronic
916047075 1:161007943-161007965 TATGAAATAGATGAGGAGGATGG - Intronic
916311404 1:163402628-163402650 CTTGAGATACATGAAGAGGAGGG + Intergenic
916962410 1:169902554-169902576 TTTAATATACTTGCTGATGATGG - Intergenic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917188840 1:172391748-172391770 TTTCAGATACAAGAGGAGAAAGG - Intronic
917217802 1:172696239-172696261 TGTAAAATAGAAGAGGAGGAGGG + Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
918514183 1:185344328-185344350 TTTAAAACACATGATGAGGCTGG - Intergenic
919329674 1:196155027-196155049 TTGAATATAAATGAGGAGACTGG + Intergenic
919432943 1:197519519-197519541 TATAATATCCATGAGGACAAGGG - Intronic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
920714499 1:208326912-208326934 TATAATAGACAGGAGGAGAAAGG - Intergenic
921194634 1:212743494-212743516 GTTAATGAACATGTGGAGGAAGG - Intronic
921451406 1:215310955-215310977 TTTAATATAACTGATGAGAATGG + Intergenic
921840741 1:219825709-219825731 TTTCAAATACATGAGGGAGAAGG + Intronic
923607019 1:235453371-235453393 CTTAAGGTACATGAGAAGGATGG - Intronic
1067322829 10:45238484-45238506 TTTTATATACATAAGAATGAAGG + Intergenic
1067366819 10:45639078-45639100 TTTATTATACATGAAAAGGAAGG + Intronic
1068227619 10:54126442-54126464 TTTAAGGTACATAAGGAGGCAGG - Intronic
1069017689 10:63448819-63448841 TTTAAGATACTTCAGGAGGTCGG + Intronic
1070992525 10:80745025-80745047 TCTAATCTTCCTGAGGAGGATGG - Intergenic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1075851359 10:125590414-125590436 TTTAAAATAAAAGAGAAGGAGGG - Intronic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1080790757 11:35520616-35520638 TTTAAAATAAAAGAGGAGGGAGG + Intronic
1080869235 11:36222595-36222617 TTTAATTTGCATCTGGAGGAGGG + Intronic
1081082393 11:38758274-38758296 TTTAATGTACATGACTAGAACGG - Intergenic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1081487329 11:43541568-43541590 TTTCATAGACAAGAGGATGATGG + Intergenic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1082178852 11:49094553-49094575 GATAATATACAAGATGAGGATGG - Intergenic
1085548139 11:77340057-77340079 TTTAATAGCAATGAGGAGAAAGG + Intronic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086222332 11:84463334-84463356 TCTGATATTCCTGAGGAGGATGG - Intronic
1086240208 11:84681462-84681484 TGTAATATACATTAGGAAGTGGG + Intronic
1087733927 11:101810414-101810436 ATTAATATACAGGAAGGGGATGG + Intronic
1089204032 11:116743962-116743984 TATAATATGCATCAGGAAGAAGG - Intergenic
1089803328 11:121057592-121057614 TTGAAAATACATGGGGAAGAAGG + Intronic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1093052823 12:14522466-14522488 TTCAAAAGACATGAAGAGGAGGG + Intronic
1093096861 12:14981825-14981847 TTTATTAAATATGAGGAGGTGGG - Exonic
1093187038 12:16031954-16031976 TTTAAGATACATTTGAAGGAAGG + Intronic
1093490389 12:19698633-19698655 TTTAATATATTTGAGGACCAGGG + Intronic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094456458 12:30639955-30639977 TTTAATTTACTTAAGAAGGAAGG - Intronic
1095928194 12:47600308-47600330 ATTAATATACATTTGCAGGAAGG - Intergenic
1096834717 12:54342401-54342423 TTTATTATACAAGGGGAAGAAGG - Intronic
1098268236 12:68745210-68745232 TTTAAAATAAATGAGGAAGTAGG - Exonic
1099321537 12:81156861-81156883 TTTAAAATAGAAGAGGAGGCAGG + Intronic
1099868957 12:88322107-88322129 ATAAACATCCATGAGGAGGATGG + Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100108578 12:91208818-91208840 ATTAATATACATATGAAGGAAGG - Intergenic
1100700771 12:97145448-97145470 TTTAGTCTGCATGAGGTGGAGGG - Intergenic
1102911587 12:116718787-116718809 TTTAAAGGAAATGAGGAGGAAGG - Intronic
1104577920 12:129984926-129984948 TTTAATTTACAGGGGGAGGAGGG - Intergenic
1106325017 13:28680647-28680669 TTTAATATATATGAGAACAAAGG + Intergenic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1106414142 13:29531975-29531997 TTTAATAAACCTGAGAGGGAGGG - Intronic
1107791501 13:44006571-44006593 TTTAGTATAGATGAGGAGGCAGG - Intergenic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1109749165 13:66666906-66666928 TTAAATATAAAAGAGGAGGAGGG - Intronic
1109924209 13:69113353-69113375 TTTTATATACATCAGGAAGGCGG - Intergenic
1110729312 13:78861061-78861083 TTTAAAATACATGAGGGAGGTGG + Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1112211588 13:97383061-97383083 TATGATATAAATGAGGATGAAGG - Intronic
1112855045 13:103758000-103758022 TTTATTATTCATTAGGTGGAAGG - Intergenic
1113350922 13:109528525-109528547 TTTAATACATTTCAGGAGGATGG - Intergenic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1117143884 14:52817223-52817245 AATAATATAGATCAGGAGGAAGG - Intergenic
1117262958 14:54055583-54055605 TTTAAAATACATGACAAGGATGG - Intergenic
1117938122 14:60930462-60930484 TTTAATATACTTCAGAAGGAAGG - Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1120311252 14:82831050-82831072 TATAATGTACATGAAGAGGTTGG + Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1123677849 15:22729566-22729588 TTTCATTTACATGATGGGGAAGG - Intergenic
1124112226 15:26801721-26801743 ATTAATCTAAATGAGGAAGAAGG + Intronic
1124330050 15:28803830-28803852 TTTCATTTACATGATGGGGAAGG - Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1131244960 15:90783148-90783170 TATAATATACGTGTGTAGGAGGG - Intronic
1131742430 15:95408720-95408742 TTAAATATACATCTTGAGGAGGG + Intergenic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1134488030 16:14674161-14674183 AGTAATATACTTGAGCAGGAAGG + Intronic
1135496391 16:22955291-22955313 GATCATATACATGAGGAGCATGG + Intergenic
1138663855 16:58545921-58545943 TTTTATCTACATGAAGAAGATGG - Intronic
1139186894 16:64816943-64816965 TTTCAAATAATTGAGGAGGAGGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1144246991 17:13376479-13376501 TTAAATATAGATGTGGATGAAGG - Intergenic
1144637747 17:16921099-16921121 GTTCATTTACATGAGGAGGTTGG - Intergenic
1144956272 17:19020382-19020404 GTTGACACACATGAGGAGGATGG - Exonic
1147454192 17:40525585-40525607 TTTAAGATACATGAGGACTGAGG + Intergenic
1147507617 17:41035108-41035130 TTTAAGAAACATGAGGAGTTAGG - Intergenic
1149965492 17:61159556-61159578 TTTAACATCCTTGAGGAGGTGGG + Intronic
1150560991 17:66294776-66294798 TTTAATACACATGAGCAGCCGGG - Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1155474916 18:26227558-26227580 GTTAATTTCCATGTGGAGGATGG + Intronic
1156883632 18:42109276-42109298 TTTAAAACACAAGAGAAGGAAGG - Intergenic
1158951838 18:62502431-62502453 CTTCATACACATGAGGAGGATGG + Intergenic
1159367426 18:67486614-67486636 CTTAATGTAAAAGAGGAGGATGG - Intergenic
1159606672 18:70481416-70481438 TTTAAAATTCATGTGGAGGTTGG - Intergenic
1159877436 18:73828062-73828084 TTTCATATTCACGAAGAGGAAGG + Intergenic
1160120800 18:76129092-76129114 TTTAAAATACATTAGGATTATGG - Intergenic
1165531065 19:36402170-36402192 TTTAAAATAGATTAGGAGGCCGG + Intronic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
927224838 2:20753972-20753994 TTAAACATACATAAGAAGGAAGG + Intronic
928839251 2:35585435-35585457 TTTGATATATATGAGGAAGCTGG + Intergenic
928974956 2:37076744-37076766 TTTAATGTATATCAGGGGGAAGG - Intronic
929488689 2:42377243-42377265 TTTACTTTACATGAGAAGGGAGG - Intronic
929532016 2:42758720-42758742 TTTTAAATACAGGAGGAGAAGGG - Intergenic
929844212 2:45504897-45504919 TTTAATAAAAACGAGGAGTAAGG + Intronic
930482678 2:51968804-51968826 TTTATTAAACACAAGGAGGAGGG + Intergenic
930718177 2:54612899-54612921 TTTGTTATACTTGAGGAGGAAGG + Intronic
930799579 2:55429141-55429163 TGAAATATAAGTGAGGAGGATGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
933337006 2:80971430-80971452 TTTAAAGTAATTGAGGAGGAGGG + Intergenic
935108795 2:100072686-100072708 CTTAATACACATGAGGAACAAGG - Intronic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
936444211 2:112583841-112583863 TTTAAGACAGATGAGAAGGAAGG + Intergenic
936835113 2:116700195-116700217 TTAAATATACTTAATGAGGAAGG + Intergenic
937272418 2:120661441-120661463 TTTAATATACCAAAGGAGGGGGG - Intergenic
937543101 2:122983460-122983482 TTTCATAGATATGAGAAGGAGGG - Intergenic
938666724 2:133546445-133546467 TGGAGTATACATGAGCAGGACGG - Intronic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939435148 2:142166603-142166625 TTAGATATACATTAGGAGGTGGG - Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940530633 2:154872608-154872630 TTTCAAATAAATGTGGAGGAGGG - Intergenic
940624424 2:156154840-156154862 TTTGATATACATTAGATGGATGG + Intergenic
941110976 2:161418459-161418481 TTTAATATAAATTTGGAGGGTGG - Intronic
941497838 2:166229102-166229124 TTTAATAAACATGAGTCGGCTGG - Intronic
941747058 2:169098087-169098109 TTTAAAATACATGAGAAGGTGGG + Intergenic
943115690 2:183667138-183667160 TTAAATATATATAAGGAGTATGG - Intergenic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
944425404 2:199577054-199577076 TTTAACATACAAGATGAAGAAGG - Intergenic
945334148 2:208571622-208571644 TTAACTATACATGAACAGGAGGG - Intronic
945500973 2:210574624-210574646 TTTAATATAGATCAGCATGATGG + Intronic
947013232 2:225589371-225589393 TTTAATATACATTTTGAGGTTGG + Intronic
948156035 2:235782323-235782345 AATAATATACATGAGAAAGATGG - Intronic
948966489 2:241385423-241385445 GTCAATATAAATGAGTAGGATGG + Intronic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1169920092 20:10726141-10726163 GCTAATATACTTGAGAAGGAGGG + Intergenic
1170480398 20:16759713-16759735 TTTCAGATAGATGAGGATGATGG - Intronic
1170559068 20:17540406-17540428 ATTAATATACATGAGGGGTTGGG - Intronic
1171027295 20:21642424-21642446 TTTAAAATACAGGTGGGGGATGG - Intergenic
1171029833 20:21667713-21667735 TTTACTATCAATGTGGAGGAAGG - Intergenic
1173559588 20:43993409-43993431 TTTGAGATACATGGGGAGGTGGG + Intronic
1174215181 20:48911138-48911160 TTTAAGACAAATGAGGTGGAAGG - Intergenic
1176688528 21:9876681-9876703 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1178168082 21:30005610-30005632 TTTGAAATAAAAGAGGAGGAAGG - Intergenic
1178539419 21:33436814-33436836 TTTTAAATACTTGAGGAGGTTGG - Exonic
1179022032 21:37649200-37649222 TGTAAGATAAGTGAGGAGGAGGG - Intronic
1179265012 21:39795544-39795566 TCTAGTATGAATGAGGAGGAAGG + Intronic
1179362681 21:40727345-40727367 AATCACATACATGAGGAGGAAGG - Intronic
1180702521 22:17789375-17789397 TTTAACATATGTGCGGAGGAAGG + Exonic
1183685767 22:39360624-39360646 TTTAATATACATGCTGAGCACGG + Intronic
1183839294 22:40484741-40484763 TTCAACATACATGAGTAGAAGGG + Intronic
1184408657 22:44314044-44314066 TTTAATCTTCATGATTAGGAGGG + Intergenic
949241711 3:1880522-1880544 TATATTATACATGAGGAGTGGGG - Intergenic
952040420 3:29255023-29255045 TTTAATATTCGTGATGATGATGG + Intergenic
952467852 3:33609990-33610012 TTGGATATAGATGAGGAGGGTGG - Intronic
952548022 3:34443831-34443853 TTTAAAATATATGTAGAGGAGGG - Intergenic
953863309 3:46563576-46563598 TTTACTTTAGATGAGGAGGCTGG - Intronic
956834663 3:73086819-73086841 ATTAAGAGCCATGAGGAGGAAGG + Intergenic
957852448 3:85826778-85826800 TTTAATATACATTTTGAGGTGGG - Intronic
957858153 3:85906187-85906209 TTAAATATATTTGAGGAGAAAGG + Intronic
959356083 3:105330317-105330339 TATAATATATATAAGGTGGATGG + Intergenic
959881740 3:111451291-111451313 TTTCAAAAACTTGAGGAGGAGGG + Intronic
960143194 3:114171338-114171360 TTTAATGTATATGAGGGTGAGGG - Intronic
960312930 3:116139064-116139086 TATAATATACATTATCAGGAGGG + Intronic
960394508 3:117119783-117119805 TATAGTATACTTGAGGAGGTTGG - Intronic
960427846 3:117531061-117531083 ATAAATATAAATGAAGAGGAGGG - Intergenic
960645186 3:119872532-119872554 TTTGACAGAAATGAGGAGGATGG + Intronic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
965933319 3:174073984-174074006 TCTAATATAAATGTGGAGAATGG + Intronic
966058928 3:175732362-175732384 TTTACTATTCATGAGAAGAATGG - Intronic
966238146 3:177725743-177725765 ATAAAGAGACATGAGGAGGATGG + Intergenic
967027993 3:185581268-185581290 TTTATTAGATATGAGAAGGAAGG + Intergenic
967426234 3:189330467-189330489 TTTAGGATAAATAAGGAGGAAGG - Intergenic
967709708 3:192692104-192692126 TTTAAAATAGATGAATAGGATGG - Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971156947 4:24093429-24093451 TTTACTAGAGATGAGGTGGAAGG - Intergenic
972108666 4:35526414-35526436 TTTAATATACATGAACATTATGG + Intergenic
972727013 4:41753575-41753597 TTTATAATACATGTGGAAGAGGG + Intergenic
973596379 4:52494855-52494877 TTTAGTATACATGATGCTGAAGG - Intergenic
975871565 4:78784937-78784959 TTTTAGATAAATGAGGAGCATGG + Intronic
976628205 4:87209240-87209262 TTTAATATATTTGAGGAAGGAGG - Intronic
977304572 4:95306495-95306517 TATAAAATACATGAAGAGGCAGG - Intronic
978832967 4:113111926-113111948 TTTCATATCCATGAGGACAAGGG + Intronic
979304151 4:119122903-119122925 TTTATTATACAAGTGGGGGAAGG - Intergenic
979953450 4:126924559-126924581 GTTAATATACAGGAGGAAGGAGG - Intergenic
980208814 4:129758218-129758240 TTAAATCTAGGTGAGGAGGAAGG - Intergenic
980351913 4:131694480-131694502 TCTAAAATAATTGAGGAGGAGGG - Intergenic
980729014 4:136803612-136803634 TTTATGATACATGAGCAGGAAGG + Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
982643852 4:157997460-157997482 TTTAAGTTAGATAAGGAGGAAGG + Intergenic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
984823169 4:183902018-183902040 GTTAATATATCTGACGAGGAAGG + Intronic
987468165 5:18296769-18296791 ATTAATTTACATGAGGAAGAGGG - Intergenic
989789750 5:45383397-45383419 TTTAAATTCCATGAGGAGGCTGG + Intronic
990088549 5:52010601-52010623 CATAATATGCATGACGAGGATGG + Intronic
990109196 5:52303258-52303280 TTGAGTATACCTGAGTAGGAAGG + Intergenic
990451847 5:55940651-55940673 GTTAATATAAAAGAGGAGCAAGG - Exonic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
993408090 5:87537342-87537364 TTTACTAAATAAGAGGAGGAAGG + Intergenic
994096970 5:95856300-95856322 GTTTATAAACATGTGGAGGAAGG - Intronic
995098626 5:108271228-108271250 TTTAATAGACTGGAAGAGGAAGG - Intronic
995975266 5:118027756-118027778 TTTAAGATACTTAAGTAGGATGG - Intergenic
996696773 5:126405723-126405745 TTTAATATAAAATAGCAGGATGG - Intronic
998246479 5:140511109-140511131 TTTAATATATATGAGAGGCATGG - Intronic
998630443 5:143892280-143892302 ATTAATAAACATGAGTGGGAAGG + Intergenic
999082719 5:148859239-148859261 TTTCATTTAAATGAGAAGGATGG + Intergenic
1000395263 5:160768157-160768179 TTTAAAATTCATGATGATGATGG - Intronic
1001840563 5:174873026-174873048 CTTAAAATGCATGAGGGGGAGGG - Intergenic
1003918723 6:10811901-10811923 TATAAACTACAGGAGGAGGATGG + Intronic
1009358068 6:62776803-62776825 TTTAAAATAGATTAGGAGGGTGG - Intergenic
1011197801 6:84800229-84800251 ATTAATATTCATGATGATGATGG - Intergenic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1013437979 6:110132385-110132407 TTTCATATACATAAGGATGATGG + Intronic
1013834993 6:114324045-114324067 TATAAGATTCAAGAGGAGGAAGG + Intronic
1015034667 6:128638761-128638783 TTCAAAATACATTAGGACGAAGG + Intergenic
1015547647 6:134377653-134377675 TCTAATATAAATGAGGGGGCTGG + Intergenic
1017201149 6:151756198-151756220 TAAAATGTACATGGGGAGGAGGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018273639 6:162106987-162107009 TTCAATACACATGAGGAGCTCGG + Intronic
1018405757 6:163480436-163480458 CTTAAAAGACATGAGGCGGAGGG - Intronic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1021222849 7:17993134-17993156 TTGCATATACATGATGAGGGAGG - Intergenic
1021238933 7:18177189-18177211 AATAAAATACGTGAGGAGGAAGG + Intronic
1021920773 7:25482660-25482682 TGTATTATACATGAGGTGTATGG - Intergenic
1022311567 7:29200973-29200995 TTAATTATAAATGAGGAGAAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026518555 7:71094613-71094635 TTTTACATACACGAGGAGGTAGG - Intergenic
1027873723 7:83743413-83743435 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1027874434 7:83750324-83750346 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1028567732 7:92251262-92251284 TTTAAAATCCATGAAGAGAAGGG + Intronic
1029077990 7:97950891-97950913 TTTAATATCCAGGAGGCGGGAGG + Intergenic
1030847186 7:114434427-114434449 TTTAATATATATGGGGGGGGGGG + Intronic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1031536486 7:122940023-122940045 TTTCATAAAATTGAGGAGGAGGG - Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1033111578 7:138583179-138583201 TGTATTATACAAGAGGAAGAAGG - Intronic
1034143386 7:148844981-148845003 TTTAATCTTCATGATAAGGAAGG - Intronic
1037096655 8:14994285-14994307 TTTAAGATGCATGAGGGGGCTGG + Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038724971 8:30073600-30073622 TTTTATATACTTGAGGGTGAGGG - Intronic
1039135454 8:34317970-34317992 TTTAATATAGCTGATGAGCAAGG - Intergenic
1040806623 8:51403615-51403637 TTTGAGATACATGAGAAGTAGGG - Intronic
1040886994 8:52275669-52275691 TTTAATATTTTTTAGGAGGAAGG + Intronic
1042472975 8:69212329-69212351 TTTCATCTGCATGAGAAGGATGG + Intergenic
1042583869 8:70313572-70313594 TTTCATATATATGAGGTGAAGGG - Intronic
1043178277 8:77049519-77049541 ATTAATATTCATGAGTAAGATGG - Intergenic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1044513137 8:93107342-93107364 TTTATTATATTTGAGGGGGATGG - Intergenic
1045025903 8:98086369-98086391 TTTAATCTTCATGAAGATGAAGG - Intronic
1045632045 8:104135792-104135814 TTAAGTATAAATGAAGAGGAAGG + Intronic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1050338494 9:4612809-4612831 ATTAATATTCAGGAGGGGGATGG + Intronic
1050624641 9:7489793-7489815 TGTAATATGGATGAGGTGGAAGG - Intergenic
1052874283 9:33541932-33541954 TTTTGTCTACATGAGAAGGATGG - Intronic
1053501754 9:38602432-38602454 TTTTGTTTACATGAGAAGGATGG + Intergenic
1053780805 9:41605217-41605239 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1054168748 9:61815374-61815396 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1054668783 9:67765437-67765459 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1055122764 9:72681689-72681711 TTTTATATACGTAAGAAGGAGGG - Intronic
1055131623 9:72781918-72781940 TTTCAAAAACTTGAGGAGGAGGG + Intronic
1055378508 9:75679263-75679285 TTTCATATTCATGAATAGGAAGG + Intergenic
1057681145 9:97186735-97186757 ATTTATCTACATGAGAAGGATGG + Intergenic
1058399538 9:104598631-104598653 CTTCATGTACATGAGGAAGATGG + Exonic
1058400001 9:104604845-104604867 CTTCATGTACATGAAGAGGATGG + Exonic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1058570608 9:106338610-106338632 TTTAAAATACATGAACAGGTAGG - Intergenic
1059681867 9:116593408-116593430 TTTAACATACATGTGGAGAATGG - Intronic
1059717466 9:116926883-116926905 TTAAATATATATGAGGGAGAGGG + Intronic
1061765751 9:132880144-132880166 CTTAAAATAAATGAGGAGAAAGG - Intronic
1188564886 X:31515347-31515369 TTTAATATAGCTGAGAAGTAAGG + Intronic
1188796243 X:34469272-34469294 TTTACTATATATGGGGAGGGAGG - Intergenic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1193151460 X:78128900-78128922 TTTAATATACATTAAGAGGCCGG + Exonic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1195409835 X:104557858-104557880 TTTAAAATATTTGAGGAGGGCGG - Intergenic
1195711998 X:107780338-107780360 ATTAATATATATAAGGAGGTTGG - Intronic
1196659608 X:118256150-118256172 TTCAATATACATAAGAAAGAAGG + Intergenic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1200653778 Y:5874096-5874118 TTTAATATAGCTGGGAAGGATGG + Intergenic
1201169027 Y:11238852-11238874 TTTCATACTGATGAGGAGGAAGG - Intergenic
1201934943 Y:19400077-19400099 TTTCAAATAATTGAGGAGGAGGG + Intergenic