ID: 1121908764

View in Genome Browser
Species Human (GRCh38)
Location 14:97770257-97770279
Sequence CAGGGCAGACAGAGCTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121908764_1121908772 17 Left 1121908764 14:97770257-97770279 CCCTGTCAGCTCTGTCTGCCCTG No data
Right 1121908772 14:97770297-97770319 ACTCTAGCAGAACATGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121908764 Original CRISPR CAGGGCAGACAGAGCTGACA GGG (reversed) Intergenic
No off target data available for this crispr