ID: 1121912134

View in Genome Browser
Species Human (GRCh38)
Location 14:97801427-97801449
Sequence GCTATGTGCAAAGACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121912129_1121912134 11 Left 1121912129 14:97801393-97801415 CCTCCCACATAAAAGACTTATCC No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912130_1121912134 8 Left 1121912130 14:97801396-97801418 CCCACATAAAAGACTTATCCCTC No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912126_1121912134 29 Left 1121912126 14:97801375-97801397 CCCCTTGGGCATTTGATGCCTCC No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912128_1121912134 27 Left 1121912128 14:97801377-97801399 CCTTGGGCATTTGATGCCTCCCA No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912132_1121912134 -10 Left 1121912132 14:97801414-97801436 CCCTCTTTTAATAGCTATGTGCA No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912127_1121912134 28 Left 1121912127 14:97801376-97801398 CCCTTGGGCATTTGATGCCTCCC No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data
1121912131_1121912134 7 Left 1121912131 14:97801397-97801419 CCACATAAAAGACTTATCCCTCT No data
Right 1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121912134 Original CRISPR GCTATGTGCAAAGACAGTGT TGG Intergenic
No off target data available for this crispr