ID: 1121920527

View in Genome Browser
Species Human (GRCh38)
Location 14:97876709-97876731
Sequence CATAGCTGCTGCCTTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121920518_1121920527 23 Left 1121920518 14:97876663-97876685 CCCTTAATTTATTTGGTGTCTGA No data
Right 1121920527 14:97876709-97876731 CATAGCTGCTGCCTTGATGGAGG No data
1121920517_1121920527 24 Left 1121920517 14:97876662-97876684 CCCCTTAATTTATTTGGTGTCTG No data
Right 1121920527 14:97876709-97876731 CATAGCTGCTGCCTTGATGGAGG No data
1121920519_1121920527 22 Left 1121920519 14:97876664-97876686 CCTTAATTTATTTGGTGTCTGAA No data
Right 1121920527 14:97876709-97876731 CATAGCTGCTGCCTTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121920527 Original CRISPR CATAGCTGCTGCCTTGATGG AGG Intergenic
No off target data available for this crispr