ID: 1121925773

View in Genome Browser
Species Human (GRCh38)
Location 14:97926061-97926083
Sequence CAGGGTTGCAAGGATGAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121925773_1121925783 23 Left 1121925773 14:97926061-97926083 CCTGACTCATCCTTGCAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1121925783 14:97926107-97926129 GGAGAAGTGTCCATGAAGTCTGG 0: 1
1: 0
2: 4
3: 12
4: 147
1121925773_1121925778 2 Left 1121925773 14:97926061-97926083 CCTGACTCATCCTTGCAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1121925778 14:97926086-97926108 ACAACGCCCAGGCCCTGACATGG 0: 1
1: 0
2: 1
3: 11
4: 110
1121925773_1121925775 -9 Left 1121925773 14:97926061-97926083 CCTGACTCATCCTTGCAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1121925775 14:97926075-97926097 GCAACCCTGACACAACGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121925773 Original CRISPR CAGGGTTGCAAGGATGAGTC AGG (reversed) Exonic
900703505 1:4062108-4062130 CAGGGTTGGAGGGATGGGTCGGG + Intergenic
901701118 1:11045214-11045236 CAGGGTGGCACTGATGAGCCTGG + Intronic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
903665650 1:25005882-25005904 CAGGGCTGGAAGGTTCAGTCAGG + Intergenic
905462919 1:38133292-38133314 CAGGATTGCGAGGAAGAGGCAGG - Intergenic
905891533 1:41521407-41521429 CGGGGGTGCAGGGAGGAGTCAGG + Intronic
906205171 1:43982672-43982694 CTGGGTAGCAAAGATGAGGCTGG + Intronic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
908934692 1:69360470-69360492 CAGGGTTGCAAGGGTTGCTCAGG - Intergenic
909508100 1:76418019-76418041 CAGGCTGGCAAAGATGAGCCAGG - Intronic
909608558 1:77530991-77531013 GAGGGGTGCAAGGATGAGTGTGG + Intronic
912419014 1:109530942-109530964 CAGGACTGCAAGGAAGAGGCTGG + Intergenic
912460137 1:109824945-109824967 CAGAGTTTCAAGGTTGAGACAGG + Intergenic
912628091 1:111222908-111222930 AAAGGTTGGAAGGATGAGTGGGG - Intronic
915130731 1:153693735-153693757 CAGGGTAGCAAGGCTGAGGGAGG - Exonic
915270378 1:154749587-154749609 CAGGGTGCCAAGGAGGAGCCTGG + Intronic
916471240 1:165124892-165124914 CAGGGTGGGAAGGCTGACTCTGG + Intergenic
917646326 1:177032473-177032495 CAGGGCTGCAATGAAAAGTCGGG - Exonic
917733749 1:177901683-177901705 CACAGTTACAAAGATGAGTCAGG - Intergenic
917811218 1:178660097-178660119 CAAGGTGTCAAGGATGAGTGTGG + Intergenic
922084650 1:222334565-222334587 CACAGTTCCAAGGCTGAGTCAGG + Intergenic
922088065 1:222369762-222369784 CAGGGTCTCCAGGAAGAGTCAGG + Intergenic
922704384 1:227781393-227781415 CAGGGCTGCAAGGAAGGGTGCGG + Intergenic
923230819 1:231984601-231984623 CAGGGGTACAAGGATGAGTAAGG + Intronic
924318607 1:242824556-242824578 CAAGGGTGAAAGGATGAGTCAGG + Intergenic
924462219 1:244269649-244269671 CAGGGTTGCCAGGCTGTGTGTGG - Intergenic
924599879 1:245479089-245479111 GAGGGCTGGATGGATGAGTCTGG + Intronic
1063669749 10:8090521-8090543 TAGAGTTGGAAGGATGAGTAGGG + Intergenic
1067553731 10:47253518-47253540 CAGGGTTGGAGGGATGAAGCAGG + Intergenic
1067571909 10:47377998-47378020 CAGGCTTGGCAGGATGGGTCTGG + Intronic
1067693696 10:48520484-48520506 CAGGGGGGCCAGGATGAGTGGGG + Intronic
1067749048 10:48957907-48957929 AACAGTTGCAAGGCTGAGTCAGG + Intronic
1067830175 10:49607224-49607246 CGGGGTTGCAAGGAGGCGTCAGG - Intergenic
1069810168 10:71153495-71153517 CTGGGTTACATGGAGGAGTCGGG + Intergenic
1069873537 10:71547690-71547712 CAGAATTGCAAGGAAGAGTCTGG + Intronic
1070388963 10:75952091-75952113 CAGGGTTTCTGAGATGAGTCTGG - Intronic
1070846090 10:79523749-79523771 CAGGGTTGTGAGGAGGACTCTGG + Intergenic
1070927707 10:80236561-80236583 CAGGGTTGTGAGGAGGACTCTGG - Intergenic
1074669115 10:115767594-115767616 CATAGGTGCAAGAATGAGTCTGG - Intronic
1074900080 10:117808700-117808722 CAGATTTGCTAGGATGAGGCAGG + Intergenic
1078534007 11:12159009-12159031 CAGGGTGGCAAGTCTGAGCCTGG + Intronic
1078545890 11:12246710-12246732 CAGGGGTGGAAGGCTGAGGCAGG - Intronic
1080129250 11:28773901-28773923 TAGGGTTGCAGAGATCAGTCTGG + Intergenic
1080915665 11:36656192-36656214 CTGGGTTGCTAGGATGAGGTAGG + Intronic
1083127913 11:60590998-60591020 CAAGTCTGTAAGGATGAGTCTGG - Intergenic
1085057160 11:73411731-73411753 CAGGGCTGCATGGATGATTCTGG + Intronic
1085733715 11:79021018-79021040 CAGGGATGCAAAGATGAATAAGG - Intronic
1085809483 11:79667364-79667386 CAGGGTTGCCAGCATGGGCCTGG + Intergenic
1087045749 11:93842620-93842642 CTGGGTGGCAAGACTGAGTCAGG + Intronic
1087407677 11:97750389-97750411 CAGGGTTTAAAGGCAGAGTCAGG - Intergenic
1088070952 11:105784491-105784513 CAGGGTTTCAAAGATGAGAAAGG - Intronic
1089048776 11:115527727-115527749 CAGGGTAGGGAGGATGAGTTGGG + Intergenic
1089094857 11:115911340-115911362 CAGGTTTGCTAGGAGGTGTCAGG + Intergenic
1090460099 11:126883477-126883499 CAGAGTTGCCAGCATGAGTAAGG - Intronic
1091239020 11:134040099-134040121 CAGGCTTGCAAGGGTGAATGTGG - Intergenic
1091254666 11:134173084-134173106 CAGGGCTGCAGGAATGAGTGGGG + Intronic
1094340442 12:29405315-29405337 AAGGATTGCATTGATGAGTCTGG - Intergenic
1095309343 12:40679348-40679370 CAGAGTCACAAGGTTGAGTCTGG - Intergenic
1096814493 12:54193358-54193380 CAGGGTAGCGAGGCTGAGCCAGG - Intergenic
1097440191 12:59598386-59598408 CAGGGTTGCCAAGATGAATGAGG + Intronic
1098971258 12:76859240-76859262 CTGAGTTGCAAGCATGAGTCAGG + Intronic
1100340825 12:93677822-93677844 CAGGGTTGCGAGGGGGAGTGTGG + Exonic
1102209882 12:111118683-111118705 CATGTTTGCAAGGATGAATGTGG - Intronic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1103034056 12:117642042-117642064 CAAGGCTGCAAGGCTGAGTAGGG - Intronic
1104108677 12:125686638-125686660 CAGGGTTGCGAGGATGAACTGGG - Intergenic
1104779276 12:131409453-131409475 AAGGGTTACAGGGATGAGTTGGG + Intergenic
1106470424 13:30049494-30049516 CAGGATTGCAGAGATGAGTCTGG + Intergenic
1106922989 13:34584458-34584480 AAAGGTTGGAAGGAAGAGTCAGG - Intergenic
1107737401 13:43414630-43414652 CAGAGTAGCAAGGCAGAGTCAGG + Intronic
1109233851 13:59791902-59791924 CTAGGTTGAAAGGAGGAGTCAGG - Intronic
1111365905 13:87244630-87244652 CAGGGCTGCAGGGAAGAGGCAGG - Intergenic
1121925773 14:97926061-97926083 CAGGGTTGCAAGGATGAGTCAGG - Exonic
1121974924 14:98394048-98394070 CAGCTTTGCATGGATGGGTCTGG + Intergenic
1124652563 15:31484348-31484370 AAGGGCAGCAAGGAGGAGTCTGG - Exonic
1125663727 15:41414444-41414466 CATGGTTCCAAGGATATGTCGGG + Intronic
1127255363 15:57286867-57286889 CAGGGCTGCACGGAGGAGGCTGG - Exonic
1129261211 15:74368462-74368484 CTGGGCTGGAAGGATGGGTCTGG - Intergenic
1129323306 15:74786743-74786765 CAGGGTTGCCAGGAGGAGACTGG - Intronic
1130536143 15:84786376-84786398 TGGGCTTGCAAGGATGAGTTTGG + Intronic
1132812237 16:1806287-1806309 CATGTTAGCCAGGATGAGTCTGG + Intronic
1133548275 16:6829006-6829028 AAGGAATTCAAGGATGAGTCAGG - Intronic
1134016407 16:10891545-10891567 CGGAGTTGCTAGGATCAGTCTGG + Intronic
1134213849 16:12300644-12300666 CAGGGTTACAAGTATGCATCTGG - Intronic
1134618919 16:15672950-15672972 CAGCGTTGGAAGGATGAGGAGGG - Intronic
1136589365 16:31208192-31208214 CAGGGGGGCAAGGGTGAGCCTGG - Intergenic
1137401381 16:48156628-48156650 CAGGGTTCCAAGGGTGACACAGG - Intergenic
1139953398 16:70682399-70682421 CAAGGTTTCAAGGCTGAGTGGGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141749077 16:85946346-85946368 GAGGGTTGCAAGGACGAATTTGG - Intergenic
1143762509 17:9115660-9115682 CCGGGGGGGAAGGATGAGTCAGG - Intronic
1145013671 17:19383587-19383609 CAGGGGAGCAAGGAGGAGCCAGG + Exonic
1145985446 17:29042968-29042990 CAGGGATGCAAGGGTGAGGCTGG + Exonic
1150838912 17:68590283-68590305 CAGAGTTGCAAGGAGGCCTCAGG + Intronic
1151898818 17:76998162-76998184 CAGGGCTGCATGGCTGAGTATGG - Intergenic
1151988542 17:77559233-77559255 CAGGGATGCAGGTATGAGCCTGG + Intergenic
1153889672 18:9501240-9501262 GAGAGGTGCAAGGATGAGGCAGG - Intronic
1154033969 18:10780390-10780412 CAGGGATGCAATGAGGAGACAGG + Intronic
1155366026 18:25049937-25049959 CAGGGTCTCAAGGCTGAGTGTGG - Intergenic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1157982944 18:52403431-52403453 CAGGGTGTTAAGTATGAGTCTGG - Intronic
1165831697 19:38733782-38733804 CTGGGCAGGAAGGATGAGTCAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925537904 2:4935992-4936014 AAGGCTTTCAGGGATGAGTCAGG - Intergenic
927593609 2:24378024-24378046 CAGGTTTGGAGGGATGAGCCTGG - Intergenic
927940848 2:27101953-27101975 CAGGGATGCAAGGGTGTGTTAGG - Intronic
930501565 2:52226390-52226412 CAGGGTTTGAAGAATGAATCAGG + Intergenic
936616188 2:114050099-114050121 CAGGGTTCTTATGATGAGTCAGG - Intergenic
937346687 2:121130416-121130438 CAGGGGAGCAAGGCTGAGGCAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939326659 2:140699422-140699444 GATGGTTGCAGAGATGAGTCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942496616 2:176546905-176546927 CAGGGTAGCAAGGCTAGGTCTGG + Intergenic
944098627 2:195997308-195997330 CAGGTTGGCCAGGATGGGTCCGG - Intronic
945593355 2:211762219-211762241 CAGGGTTGAAATGATCAGTAAGG + Intronic
947120480 2:226809042-226809064 CAGAGTTGAAAAGATGAGTCTGG + Intergenic
948245573 2:236481335-236481357 CAGGGTAGAAACCATGAGTCTGG + Intronic
1173366864 20:42393899-42393921 CAGAATTGCATGGAAGAGTCAGG + Intronic
1173980105 20:47217325-47217347 TATGGTTGCAAGCATGAGTCTGG + Intronic
1178713303 21:34939991-34940013 CATGATTGCAATGATGAGGCTGG + Intronic
1179533702 21:42037939-42037961 CAGGGTTGGGAGGACGGGTCTGG + Intergenic
1182433094 22:30312224-30312246 CAGTTTGGTAAGGATGAGTCAGG - Intronic
1183115176 22:35686253-35686275 CAGGGGGGCAAGGAGGAGTTTGG + Intergenic
1183187970 22:36303291-36303313 CAGGGAGTCAAAGATGAGTCTGG + Intronic
1183467322 22:37986319-37986341 GAGGGGTGGAAGGATGAGTGGGG - Intronic
1184777097 22:46628679-46628701 CAGGGTTGCAGGTATTGGTCTGG + Intronic
1184888641 22:47366179-47366201 CAGGGATGAAAGACTGAGTCAGG + Intergenic
949966599 3:9362063-9362085 CAGGGTTGGAAGAATAAGACAGG - Intronic
951307919 3:21088122-21088144 CAGGGATGCAAGAATGGTTCAGG + Intergenic
952955364 3:38553967-38553989 GAGAGCTTCAAGGATGAGTCTGG - Intronic
957211520 3:77265136-77265158 TAGGGATGTAAGGATGAATCAGG - Intronic
961200560 3:125042492-125042514 GAGGGTTACACGGATGAATCAGG + Intronic
962612147 3:137086974-137086996 CTGGCTTGGAAGAATGAGTCAGG - Intergenic
962823075 3:139071493-139071515 CAGGGTGGAAACCATGAGTCAGG + Intronic
964549810 3:157873835-157873857 TATGGTTGCAAGGGTGAGTTGGG - Intergenic
967616830 3:191579996-191580018 CAAGGTTGCATGTATGAGTTTGG - Intergenic
968357727 3:198121841-198121863 CAAGATTGCCAGGATGAGCCTGG + Intergenic
969490768 4:7498112-7498134 CTGGGGGGCCAGGATGAGTCTGG + Intronic
969902324 4:10361160-10361182 CTGGGATGCAAGTATGAGCCAGG + Intergenic
974368146 4:60979871-60979893 CAGTATTGGAAGGCTGAGTCAGG - Intergenic
984204732 4:176772825-176772847 CAGGGTTGCAGGGCTGTGTCTGG - Intronic
985081863 4:186274024-186274046 AAAAGTTGAAAGGATGAGTCAGG + Intronic
985440834 4:189981492-189981514 CAAGATTGCCAGGATGAGCCTGG - Intergenic
986031034 5:3892720-3892742 CTGAGATGCAGGGATGAGTCAGG + Intergenic
990463887 5:56054076-56054098 CAGGATTGAAAGGCTGAGGCTGG - Intergenic
995800511 5:115988933-115988955 CAGGATGTCAAGGATGACTCTGG - Intronic
998837754 5:146219831-146219853 CAGGGTTGGAAGGAGGAGAGTGG - Intronic
1001945496 5:175774478-175774500 AAGGAATTCAAGGATGAGTCAGG - Intergenic
1005357657 6:24999855-24999877 AAGGAATTCAAGGATGAGTCAGG - Intronic
1011633872 6:89352717-89352739 CGGGGTGGCAAGGCTGAGTGCGG + Exonic
1011920917 6:92576884-92576906 CAGGGTTGCAAAGATCCGTGGGG - Intergenic
1014933180 6:127358004-127358026 CAGGGTGGGAAGGAGGAGACGGG - Intergenic
1017930497 6:158949886-158949908 CGGGGTGGCAAAGAAGAGTCAGG - Intergenic
1018080431 6:160255050-160255072 CAGGGGTGCAAGGTGGACTCCGG + Intronic
1019511529 7:1419944-1419966 CAGGGTTGCACGGAGCAGGCAGG - Intergenic
1021842248 7:24730218-24730240 CAGGATGGCTGGGATGAGTCAGG - Intronic
1024121992 7:46251887-46251909 ATGGGTTGCAATGATGTGTCAGG + Intergenic
1024377296 7:48654325-48654347 CAGGGATGTAAGAATGTGTCAGG - Intergenic
1029420529 7:100469617-100469639 CAGGGGTGCAAGGGTGGGTCGGG - Intronic
1035469931 7:159103229-159103251 CAGGGGTCCCAGGATGAGTTGGG - Intronic
1035689477 8:1550386-1550408 GATGGTTCCAAGGAGGAGTCGGG - Intronic
1036754662 8:11464322-11464344 CCGTGTTGCCAGGATGAGTCAGG - Intronic
1037859960 8:22398164-22398186 CAGGGTTGCAGGGGTGGGTGAGG - Intronic
1038148022 8:24915558-24915580 GCTGTTTGCAAGGATGAGTCTGG + Intronic
1038691896 8:29771869-29771891 AAGGCTTCCAAGGATGACTCTGG + Intergenic
1041717312 8:60943850-60943872 CAGTGTTGAAAGTATGAGACAGG - Intergenic
1044491839 8:92828836-92828858 CAGGGAAGCATGGATGAGCCTGG + Intergenic
1049062224 8:140285579-140285601 CAGGGTGGCAGAGATGAGACAGG - Intronic
1049617695 8:143582874-143582896 CAGGGTTACAGGCATGGGTCTGG - Intronic
1050541765 9:6676405-6676427 GAGAGTTGCCAAGATGAGTCTGG - Intergenic
1052104463 9:24495557-24495579 AACGGTTGCAAGGATGAGGTGGG + Intergenic
1053020094 9:34688660-34688682 CAGGATTGCAAAGATGGGGCTGG + Intergenic
1053659314 9:40255568-40255590 CAGTGTTGCAAAGATGATGCAGG - Intronic
1053909685 9:42884932-42884954 CAGTGTTGCAAAGATGATGCAGG - Intergenic
1054371441 9:64401870-64401892 CAGTGTTGCAAAGATGATGCAGG - Intronic
1054525284 9:66120648-66120670 CAGTGTTGCAAAGATGATGCAGG + Intronic
1054679062 9:67891585-67891607 CAGTGTTGCAAAGATGATGCAGG - Intronic
1055042236 9:71886709-71886731 CAGGGTTTCATGGATGAAACGGG + Intronic
1058890507 9:109356722-109356744 GAGACTTGCAAGGCTGAGTCAGG + Intergenic
1059971285 9:119671244-119671266 AAGGGTTGCATGGAGGAGTGGGG + Intergenic
1060112141 9:120913954-120913976 CTGGAGTGCAAGGATGATTCAGG + Intronic
1061238904 9:129357948-129357970 CAGGGCTGGAAGGAGGATTCCGG + Intergenic
1061928854 9:133821892-133821914 CAGGAGTGAAAGGATGAGACGGG - Intronic
1062092965 9:134688240-134688262 CAGGCTTGCGAGCCTGAGTCTGG + Intronic
1062741572 9:138178335-138178357 CAAGATTGCCAGGATGAGCCTGG + Intergenic
1187362490 X:18641467-18641489 CTGGGTGGCAGGGATGAGTGCGG - Exonic
1192483148 X:71501905-71501927 CTGGGTCGCCAGGATGTGTCCGG + Intronic
1192829798 X:74740124-74740146 CAGGTCCACAAGGATGAGTCTGG - Exonic
1193936363 X:87627015-87627037 CAGGGTGGCTAGGAAGTGTCAGG + Intronic
1194881381 X:99255717-99255739 CTGGCTTGCAAGAATGAGTTTGG + Intergenic
1196648029 X:118139363-118139385 CATGGTTTCAAGGCTGAGTGTGG + Intergenic
1197784479 X:130186794-130186816 GAGGGCTGCAAGGATGAGCCAGG - Intergenic