ID: 1121927709

View in Genome Browser
Species Human (GRCh38)
Location 14:97944063-97944085
Sequence GTGTTTCACCAGAAGCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121927709_1121927710 -8 Left 1121927709 14:97944063-97944085 CCAACTGGCTTCTGGTGAAACAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1121927710 14:97944078-97944100 TGAAACACTGCCTTGAGCTGTGG 0: 1
1: 0
2: 2
3: 18
4: 237
1121927709_1121927712 11 Left 1121927709 14:97944063-97944085 CCAACTGGCTTCTGGTGAAACAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1121927712 14:97944097-97944119 GTGGCATTAGCCTCTGTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121927709 Original CRISPR GTGTTTCACCAGAAGCCAGT TGG (reversed) Intronic
900890984 1:5449480-5449502 GTGTTCCTCCTGAAGCCACTAGG - Intergenic
901514552 1:9736264-9736286 GTGTCTCACCTGAAGCCAAGAGG + Intronic
902410953 1:16211324-16211346 GTGTGCCCCCAGAAGCAAGTGGG - Intronic
902587466 1:17449228-17449250 GTGTTTAAGGAGAGGCCAGTGGG - Intergenic
902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG + Intergenic
902696037 1:18141542-18141564 GTGGATCACCAGTAGCCACTGGG + Intronic
903137746 1:21320456-21320478 GAGTTTGGCCAGAAGTCAGTGGG + Intronic
904217443 1:28933678-28933700 GTGTTTTACAAAATGCCAGTCGG + Intronic
910552830 1:88496192-88496214 GTGGATCACCAGAAGTCAGGTGG + Intergenic
912867366 1:113269790-113269812 TGGTTTCTCCAGAAGCCACTAGG - Intergenic
914418820 1:147509633-147509655 GTGCTGCAACAGAAGCCAGAAGG - Intergenic
916646440 1:166790388-166790410 GTGAATCCCCTGAAGCCAGTAGG - Intergenic
916646468 1:166790824-166790846 GTGAATCCCCGGAAGCCAGTAGG + Intergenic
918532552 1:185539373-185539395 GTGTTTCTCCTGTAGCCCGTGGG + Intergenic
920366850 1:205452455-205452477 CTGTTCCAACAGGAGCCAGTGGG + Intronic
1066037113 10:31503043-31503065 TTGTTTCACCAGAAGAAACTAGG + Intronic
1066431772 10:35358897-35358919 ATGCTTCACCAGAACCCAGGAGG + Intronic
1070278057 10:75026798-75026820 GTGTTCCAACAAAAGCCGGTAGG + Intronic
1070337989 10:75471931-75471953 GTCTTGAACCAGAAGCCAGAGGG - Intronic
1076077877 10:127551269-127551291 TTTTTTCCCCAGAGGCCAGTGGG + Intronic
1076368925 10:129939426-129939448 GTGTTTCAGCTGATGGCAGTGGG - Intronic
1077650561 11:3967910-3967932 GTGTTACACAACTAGCCAGTAGG - Intronic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1085268160 11:75250026-75250048 GTTTTTATCCAGAAGACAGTGGG - Intergenic
1086824151 11:91475150-91475172 CTCTTTCACCAGAAGCCACTGGG - Intergenic
1086900683 11:92364380-92364402 GTGACTCTCCAGAAGGCAGTGGG + Intronic
1087990388 11:104741374-104741396 AAGTTTCACCAGAGGCCAATGGG - Intergenic
1088668654 11:112119750-112119772 GAGTTTCACCATCAGCCTGTTGG - Intronic
1089077414 11:115749423-115749445 ATGTTTCACCAGAAGACATAGGG - Intergenic
1089176390 11:116551863-116551885 GTGTTTCACCGGCAGCCAGCTGG + Intergenic
1089515327 11:119028403-119028425 GTTCATCACCAGCAGCCAGTCGG - Exonic
1090122201 11:124042411-124042433 CTGTTTCACTAAAACCCAGTGGG + Intergenic
1092081550 12:5720642-5720664 GTGTTTTCCCAGAAGCCATGAGG + Intronic
1096568215 12:52498827-52498849 GTGTTTGACCAGAAGGCCGATGG - Intergenic
1096657336 12:53099618-53099640 CTGTTCCACCAGAGGCCAGAAGG - Intronic
1097983024 12:65753633-65753655 GTGTTTCACCAGAACCTTGTTGG - Intergenic
1099916558 12:88902192-88902214 GTGTTTCCACAGTACCCAGTTGG + Intergenic
1100349645 12:93767369-93767391 GTGTTTCCTCAGTTGCCAGTAGG + Intronic
1101256939 12:102987858-102987880 GGGTTTCACCATGAGCCAGATGG + Intergenic
1101433717 12:104647295-104647317 GGTTTTCAAGAGAAGCCAGTTGG - Intronic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1108464302 13:50698994-50699016 GAGTCTCATAAGAAGCCAGTTGG - Intronic
1109836476 13:67863827-67863849 ATATTTAACCAGAAGGCAGTGGG + Intergenic
1113359824 13:109620187-109620209 GTGGATCACCAGAGGCCAGGAGG - Intergenic
1115427151 14:33273206-33273228 GATTTGCACCAGAAACCAGTGGG - Intronic
1115434753 14:33360061-33360083 GTGTGTCAGCGGAGGCCAGTGGG - Intronic
1117023190 14:51593512-51593534 GTGTTGTACCAGCAGACAGTTGG + Intronic
1118408044 14:65446371-65446393 GTGTGTCATCAGAAGGCACTTGG + Intronic
1120637779 14:86973377-86973399 GTGTGGCACCTGAATCCAGTAGG - Intergenic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1124618044 15:31256661-31256683 GGGCCTAACCAGAAGCCAGTGGG - Intergenic
1124655584 15:31504154-31504176 GTGTTTCACAAGGAAGCAGTGGG + Intronic
1125589176 15:40844047-40844069 CAGTTTCACCAGAAACCAGGGGG + Exonic
1126497269 15:49305860-49305882 GTAGTTCTCCGGAAGCCAGTTGG - Intronic
1130024386 15:80258951-80258973 GAAATTCACAAGAAGCCAGTTGG + Intergenic
1130057384 15:80538488-80538510 ATCCTTCACCAGAAGCTAGTTGG - Intronic
1130789838 15:87142291-87142313 GTGGTTCCACTGAAGCCAGTAGG - Intergenic
1133489437 16:6252662-6252684 GTGTACAGCCAGAAGCCAGTAGG + Intronic
1133863935 16:9624009-9624031 CTGTATCAGCTGAAGCCAGTGGG - Intergenic
1134471144 16:14526955-14526977 GTGTTTGACCCAAAGCCATTAGG - Intronic
1136929432 16:34406106-34406128 TTGGTTCTGCAGAAGCCAGTAGG + Intergenic
1136975142 16:35005698-35005720 TTGGTTCTGCAGAAGCCAGTAGG - Intergenic
1139254230 16:65525793-65525815 TTGCTCCATCAGAAGCCAGTTGG + Intergenic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1145025169 17:19462830-19462852 GTGGATCACTTGAAGCCAGTTGG + Intergenic
1147858274 17:43499944-43499966 CTGTTGCACCAGAACCCAGACGG + Exonic
1148739412 17:49883981-49884003 GGTTTTCACCAGGAGCCAGAAGG + Intergenic
1148840764 17:50495401-50495423 CTGTGTCCCCCGAAGCCAGTTGG + Intergenic
1153615459 18:6929617-6929639 GTGTTTCCAGTGAAGCCAGTTGG - Intergenic
1156941617 18:42774060-42774082 CAGTGTCACCAGGAGCCAGTAGG + Intronic
1158311157 18:56159936-56159958 GTGTTTCACAGGAAGACAATGGG + Intergenic
1162366963 19:10255565-10255587 GTGTTGCCACAGAGGCCAGTGGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1165819083 19:38663222-38663244 ATGTTACACAAGAAGCCGGTTGG - Intronic
927366465 2:22302697-22302719 GTGTGTTACCAGAATCTAGTGGG - Intergenic
927953569 2:27191215-27191237 GTGTGTCAGCAGAGGCTAGTGGG + Intergenic
928089169 2:28363633-28363655 ATGTTTCCCCAGCAGCCCGTGGG + Intergenic
928144942 2:28764829-28764851 GAGATTCACCTGAAGCCAGGAGG + Intronic
928202734 2:29260742-29260764 GTGAATCACCTGAAGCCAGGAGG + Intronic
929618678 2:43333160-43333182 GTATTTCAACCCAAGCCAGTGGG - Intronic
932002919 2:67900905-67900927 GTGGTACACCAGAAGGCAGAAGG + Intergenic
932171418 2:69560492-69560514 GTGTTTCAAAAAATGCCAGTAGG - Intronic
933028134 2:77288844-77288866 GTATCTCAGCAGAAGCCAATTGG + Intronic
935564918 2:104595849-104595871 AGGTCTCACCAGAAGCCAGCAGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
939359191 2:141146996-141147018 GAATTTAACCAGAAGCTAGTAGG - Intronic
941489817 2:166129480-166129502 GTGCTTTCCCAAAAGCCAGTTGG + Intergenic
941620577 2:167773713-167773735 GTGTTTCTCCCAAAGGCAGTGGG + Intergenic
943220859 2:185104354-185104376 GAAATACACCAGAAGCCAGTAGG + Intergenic
944255604 2:197620664-197620686 GTGGTTCCCAAGAACCCAGTAGG + Intronic
1173280322 20:41621208-41621230 GTACTTCACCAGGAACCAGTGGG + Intergenic
1174845026 20:53935836-53935858 GAACTTAACCAGAAGCCAGTTGG - Intergenic
1178553981 21:33569816-33569838 GTGGATCACCAGAGGCCACTAGG - Intronic
1179392536 21:41007002-41007024 GTGTTTCAAGAGAATGCAGTGGG + Intergenic
1179518059 21:41923187-41923209 GGGTTTCACCATTAGCCAGGAGG + Intronic
1181237619 22:21457164-21457186 GTCTTCCTCCAGCAGCCAGTAGG - Intergenic
1181323924 22:22030611-22030633 GTCTGTGACCAGATGCCAGTGGG - Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1183179165 22:36246986-36247008 CTGTTTGACCAGACTCCAGTTGG - Intergenic
1183307627 22:37091226-37091248 GTGTTCTTCCAGGAGCCAGTGGG + Intronic
952428880 3:33202703-33202725 TTATTTCATCAGAATCCAGTTGG + Intronic
954491726 3:50913056-50913078 GTGTCTCACCTGAAGGCAGCAGG + Intronic
954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG + Intergenic
955107891 3:55917189-55917211 CTGATTTACTAGAAGCCAGTGGG - Intronic
956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG + Intergenic
958927839 3:100178635-100178657 CAGTTACATCAGAAGCCAGTTGG - Intergenic
962670531 3:137701603-137701625 TTTTTTCCCCTGAAGCCAGTAGG - Intergenic
962672504 3:137723361-137723383 GTGTTCCACCAGGATACAGTTGG - Intergenic
962855278 3:139339550-139339572 GTCCTCCACCACAAGCCAGTGGG - Intronic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
964758189 3:160107748-160107770 GTGTTTCTGAAGAAGCCACTGGG - Intergenic
966832390 3:184020880-184020902 GTGTTTCATCTGAAGGAAGTAGG + Intergenic
971530679 4:27684707-27684729 GTGGTGCACCAGAAGAGAGTCGG + Intergenic
971881401 4:32379260-32379282 GTGTTTTACCAGATCCCAGGTGG + Intergenic
979084105 4:116383731-116383753 GTACTTCTCCAGAAGCTAGTAGG - Intergenic
980393250 4:132172557-132172579 ATGTATCACTAAAAGCCAGTTGG - Intergenic
983900727 4:173131067-173131089 GTGGATCACCAGAAGTCAGGAGG + Intergenic
984408567 4:179366365-179366387 GTGGATCACCTGAAGCCAGGAGG + Intergenic
986023964 5:3832495-3832517 GGGTTCCATCAGAAGCCAGCTGG - Intergenic
987057251 5:14205654-14205676 GTGTTTCAGAAGATGCCAGTTGG + Intronic
989573636 5:42968841-42968863 ATGTTTGCCTAGAAGCCAGTAGG - Intergenic
992015164 5:72567999-72568021 TTGGTGAACCAGAAGCCAGTTGG - Intergenic
992082383 5:73247259-73247281 GTATTTGACCAGAAACCAGACGG + Intergenic
992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG + Intergenic
997735037 5:136206937-136206959 GTGCTTCAGCAAAAGCCATTAGG - Intergenic
1001795927 5:174502403-174502425 GTGTCTCCCCAGAAGCCTCTAGG - Intergenic
1002896529 6:1383237-1383259 CTGCTCCTCCAGAAGCCAGTCGG - Intergenic
1003266982 6:4574565-4574587 GTGTTTCACCAGGATCCAGATGG - Intergenic
1003773045 6:9328572-9328594 GTGTTTCTCTAGGAGACAGTTGG + Intergenic
1004092700 6:12520803-12520825 TTGTTTCTCCATAAGCCATTGGG + Intergenic
1013164469 6:107577365-107577387 GTGGAGCACCAAAAGCCAGTTGG - Intronic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1016843024 6:148543738-148543760 GTCTTTTAGCAGAAACCAGTTGG + Exonic
1017927208 6:158921010-158921032 TTTTTTCTTCAGAAGCCAGTTGG + Intergenic
1021181514 7:17511444-17511466 GTGGTTCACCAGAAGCTACAAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022615236 7:31923092-31923114 GTGTTTCAGCATCAGCCACTCGG - Intronic
1023644849 7:42300007-42300029 GTGGCTCAACAAAAGCCAGTTGG - Intergenic
1023800066 7:43826383-43826405 GAGTTTCACCAGGTGCCAGTGGG + Intergenic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1029652119 7:101900591-101900613 GTTTTTTCCCAGGAGCCAGTTGG + Intronic
1033714535 7:143986036-143986058 GTGTGTCAACAAAAGCCAGAAGG - Intergenic
1034151626 7:148921473-148921495 TTGTTTTAACAGCAGCCAGTAGG + Intergenic
1035749004 8:1982514-1982536 GTGTTTCCTCAAAGGCCAGTGGG - Intronic
1037312369 8:17570151-17570173 GTGTCTCACCAAGACCCAGTTGG + Exonic
1037727046 8:21491435-21491457 GTCTGTCAACAGAAGCCACTGGG - Intergenic
1039206691 8:35163693-35163715 GAGATTCACCTGAACCCAGTAGG - Intergenic
1039647464 8:39303474-39303496 GAGTTTCAACTGAAGCCAGGAGG + Intergenic
1040911320 8:52521842-52521864 GGGTTTAACCTGAAGGCAGTTGG + Intergenic
1045215862 8:100147677-100147699 GCATTTCTCCAGAAGGCAGTGGG + Intergenic
1046488184 8:114913193-114913215 GTAATTCACCACAATCCAGTAGG + Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1056326743 9:85486183-85486205 GTGTATCATCAGATGCCAATTGG + Intergenic
1058868895 9:109185776-109185798 GGGTGGGACCAGAAGCCAGTTGG - Intronic
1059609770 9:115879675-115879697 GAGTCTAACCAGAAGCCAGAAGG + Intergenic
1060275483 9:122179280-122179302 GTCTTTCACCCTAAGGCAGTGGG + Intronic
1061279498 9:129589154-129589176 AAGTGTCACCAGAAGCCAGTGGG - Intergenic
1185492320 X:527046-527068 GCGTTTCTCCAGCAGCCAGCTGG - Intergenic
1189346959 X:40249024-40249046 GTGTTGGACCAAAAGGCAGTGGG - Intergenic
1192221908 X:69203201-69203223 GTGTTTAACTGAAAGCCAGTGGG + Intergenic
1193301984 X:79900125-79900147 CTGATTCACCACAAGCAAGTAGG + Intergenic
1194980557 X:100435854-100435876 GTCTTTCAACAGAAGCAATTTGG - Intergenic
1195014671 X:100766441-100766463 GAGTCTCACCTGAAGCCAGCAGG + Intergenic
1196173371 X:112614398-112614420 GTAGTTCTCCAGAACCCAGTAGG + Intergenic
1202171349 Y:22047967-22047989 CTGTTTCACCACAGTCCAGTTGG - Intergenic
1202220013 Y:22538405-22538427 CTGTTTCACCACAGTCCAGTTGG + Intergenic
1202323103 Y:23657261-23657283 CTGTTTCACCACAGTCCAGTTGG - Intergenic
1202547669 Y:26012793-26012815 CTGTTTCACCACAGTCCAGTTGG + Intergenic