ID: 1121928655 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:97952094-97952116 |
| Sequence | AGGTATTCCACAAGCAGCTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 128 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 118} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121928655_1121928659 | 25 | Left | 1121928655 | 14:97952094-97952116 | CCATAGCTGCTTGTGGAATACCT | 0: 1 1: 0 2: 0 3: 9 4: 118 |
||
| Right | 1121928659 | 14:97952142-97952164 | CCTCTAACTCAACAACCCATTGG | 0: 1 1: 0 2: 0 3: 9 4: 89 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121928655 | Original CRISPR | AGGTATTCCACAAGCAGCTA TGG (reversed) | Intronic | ||