ID: 1121928656

View in Genome Browser
Species Human (GRCh38)
Location 14:97952114-97952136
Sequence CATTTACACTGGCACATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121928656_1121928659 5 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928659 14:97952142-97952164 CCTCTAACTCAACAACCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1121928656_1121928663 18 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928663 14:97952155-97952177 AACCCATTGGATAATGGCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1121928656_1121928666 26 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928666 14:97952163-97952185 GGATAATGGCTGGGGTTTGAAGG 0: 1
1: 0
2: 1
3: 13
4: 166
1121928656_1121928662 17 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928662 14:97952154-97952176 CAACCCATTGGATAATGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 81
1121928656_1121928660 12 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928660 14:97952149-97952171 CTCAACAACCCATTGGATAATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1121928656_1121928661 16 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928661 14:97952153-97952175 ACAACCCATTGGATAATGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121928656 Original CRISPR CATTTACACTGGCACATAGT AGG (reversed) Intronic