ID: 1121928659

View in Genome Browser
Species Human (GRCh38)
Location 14:97952142-97952164
Sequence CCTCTAACTCAACAACCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121928655_1121928659 25 Left 1121928655 14:97952094-97952116 CCATAGCTGCTTGTGGAATACCT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1121928659 14:97952142-97952164 CCTCTAACTCAACAACCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1121928657_1121928659 -6 Left 1121928657 14:97952125-97952147 CCAGTGTAAATGCATCTCCTCTA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1121928659 14:97952142-97952164 CCTCTAACTCAACAACCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1121928656_1121928659 5 Left 1121928656 14:97952114-97952136 CCTACTATGTGCCAGTGTAAATG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1121928659 14:97952142-97952164 CCTCTAACTCAACAACCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121928659 Original CRISPR CCTCTAACTCAACAACCCAT TGG Intronic