ID: 1121928912

View in Genome Browser
Species Human (GRCh38)
Location 14:97954279-97954301
Sequence TACCCTAGGCTGCTTCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121928912_1121928914 0 Left 1121928912 14:97954279-97954301 CCAGCTAGAAGCAGCCTAGGGTA 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1121928914 14:97954302-97954324 TATTTGCTGCTTGCTGATTATGG 0: 1
1: 0
2: 1
3: 15
4: 200
1121928912_1121928915 3 Left 1121928912 14:97954279-97954301 CCAGCTAGAAGCAGCCTAGGGTA 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1121928915 14:97954305-97954327 TTGCTGCTTGCTGATTATGGTGG 0: 1
1: 0
2: 1
3: 16
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121928912 Original CRISPR TACCCTAGGCTGCTTCTAGC TGG (reversed) Intronic
905429832 1:37913662-37913684 TTCTCTGGGCTGCTTCGAGCAGG - Intronic
912340960 1:108914945-108914967 TTCCCTAGGCTTTTTCTTGCAGG + Intronic
915745834 1:158156957-158156979 TGCCCTAAGCAGCTTCCAGCTGG - Intergenic
1063363604 10:5476488-5476510 TACTCAGGGCTGCTTCGAGCGGG - Intergenic
1066582111 10:36891996-36892018 TTCCCTAGGCTGCTAGTAGGTGG + Intergenic
1068517049 10:58037917-58037939 TACCTTTGGCTTCTTCTGGCTGG - Intergenic
1070580413 10:77714820-77714842 CACCCATGGCTGCTTCTAGGTGG + Intergenic
1073459073 10:103655329-103655351 TAGGCTAGGCTGTTTCTAGAAGG - Intronic
1074751427 10:116591159-116591181 TACCTTTGGCTGCTCCCAGCAGG - Exonic
1075794269 10:125107561-125107583 TCCTCTAGCCTGCTTCTGGCAGG - Intronic
1075838846 10:125479800-125479822 TACCGTAGGCTGGTTCCAGGAGG - Intergenic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1079837989 11:25358836-25358858 AACCCTAAGCTGCTTCTAGTTGG - Intergenic
1080751831 11:35157865-35157887 TACTCCAGGCTACTTCTTGCTGG + Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1086119609 11:83292479-83292501 TAAACTAGGCTGCTTTCAGCAGG - Intergenic
1090620970 11:128560884-128560906 TACCTTAGTCTGCTTCCTGCAGG - Intronic
1095215208 12:39539652-39539674 TATCATAGGCTCCTTCTTGCTGG - Intergenic
1095680459 12:44968953-44968975 TTTCATAGGCTGCTACTAGCAGG - Intergenic
1096747213 12:53736903-53736925 TTCCCTTGGCTGCTTCTTGTAGG + Intergenic
1100887804 12:99091856-99091878 TACCCTATACTACCTCTAGCAGG + Intronic
1109167711 13:59056707-59056729 TCCCCTAGGCTGGTCCTATCTGG - Intergenic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1120539069 14:85732944-85732966 TTCTCAGGGCTGCTTCTAGCGGG + Intergenic
1121582978 14:95044747-95044769 GAGCCTAGGCTGGTTCTAGATGG - Intergenic
1121928912 14:97954279-97954301 TACCCTAGGCTGCTTCTAGCTGG - Intronic
1122902658 14:104788199-104788221 AACCCCAGGCTGCGTCTAGGTGG - Intronic
1127032674 15:54881061-54881083 TACCCAAGCAGGCTTCTAGCAGG + Intergenic
1132941434 16:2510351-2510373 TTCCCTTGGCAGCTGCTAGCTGG + Intronic
1134843463 16:17420545-17420567 TATCCAAGGCTTCTTCTATCTGG + Intronic
1138188219 16:54993200-54993222 TAGTCTAGTCTGCTTATAGCAGG + Intergenic
1138528516 16:57622385-57622407 CAGACAAGGCTGCTTCTAGCTGG + Intronic
1138539978 16:57682234-57682256 TCCCCTAGGCTCCTTCAAGCTGG - Intronic
1138561582 16:57803677-57803699 TGCACTAGGCTGCTTCCAGCTGG - Intronic
1139038830 16:62979726-62979748 TACTCAGGGCTGCTTCAAGCGGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145226566 17:21133584-21133606 TATCTTGGGCTCCTTCTAGCTGG - Intronic
1146473673 17:33144675-33144697 TCCCCCAGGCTGCTTCTTGTGGG - Intronic
1151687687 17:75658625-75658647 TAAGCTGGGCTGCTTCTAGAAGG - Intronic
1152454750 17:80407637-80407659 TTCTCAAGGCTGCTTCGAGCGGG - Intergenic
1167902554 19:52632920-52632942 TTCTCTGGGCTGCTTCGAGCGGG - Intronic
927654716 2:24935471-24935493 CAGCCTTGGCTGCCTCTAGCTGG - Intergenic
934967837 2:98738249-98738271 CACCTTGGGCTGCTTGTAGCTGG - Intergenic
936458627 2:112694421-112694443 GACCCTAGGCTGCTGCCAGTTGG + Intergenic
944853622 2:203744887-203744909 CACTCTATTCTGCTTCTAGCAGG - Intergenic
946844862 2:223850336-223850358 GACCCTAGGCTGCACATAGCAGG - Intergenic
1174550824 20:51360281-51360303 GACCCCAGGCTGCTACTACCTGG - Intergenic
1179479300 21:41667406-41667428 AACCCCAGGCTGCTTCTGGTGGG - Intergenic
1180873310 22:19160436-19160458 CACCCTAGACTGGTTCTGGCTGG + Intergenic
1181667027 22:24405424-24405446 GTCCCTAGGCTGCTCCTACCTGG - Intronic
1182261351 22:29074167-29074189 GACCCTAACCTGCCTCTAGCAGG - Intronic
1182264118 22:29099243-29099265 TCCCCTAGGCTGCTTCTGAGCGG - Intronic
1183724208 22:39579400-39579422 TACCCTAGCCCGCTTATGGCTGG + Intronic
1184621800 22:45684816-45684838 TACCCTAGGCTGTTTGTGGCAGG + Intronic
953825298 3:46246830-46246852 TTCCCAGGGCTGCTTCAAGCGGG + Intronic
959453542 3:106532169-106532191 GTCCCTAGGCTGCATCCAGCAGG - Intergenic
961286518 3:125809880-125809902 AACCCTAGGCTGCTCACAGCAGG - Intergenic
963789012 3:149564183-149564205 TATCCTGGGCTGCTGCTAGGAGG - Intronic
967305218 3:188052590-188052612 TACCCTGTGCTGCCTCCAGCAGG - Intergenic
967403911 3:189095234-189095256 TACCCAAATCTGCCTCTAGCAGG - Intronic
969802221 4:9577742-9577764 CACCCTAGGCTGCTCACAGCAGG - Intergenic
971385880 4:26140201-26140223 TCCCCTAGGCTGCTGCATGCTGG + Intergenic
972074416 4:35067050-35067072 TACCTTATGCTGCTTTTAGGGGG - Intergenic
973553098 4:52054676-52054698 GACCATAGGCTGGTTCTGGCCGG - Intronic
975152545 4:71036709-71036731 TTCTCAGGGCTGCTTCTAGCGGG - Intergenic
976830655 4:89309880-89309902 TACACTAGGCCGCTTCTAAAAGG + Intergenic
977010698 4:91629121-91629143 TACTCAGGGCTGCTTCAAGCGGG - Intergenic
983396065 4:167197091-167197113 TACCTTAGGGTGCATCTACCAGG + Intronic
983448469 4:167881498-167881520 TTCTCAGGGCTGCTTCTAGCAGG - Intergenic
986554608 5:8998873-8998895 TTCTCAGGGCTGCTTCTAGCGGG + Intergenic
992251787 5:74883256-74883278 TTCTCAAGGCTGCTTCTAGCGGG + Intergenic
995239158 5:109866103-109866125 TACCCTACCCTGCTTGGAGCTGG + Intronic
997424451 5:133793754-133793776 AACCCGGGGCTGCTTCTAGTAGG - Intergenic
997948250 5:138221320-138221342 AATCCTGGGCTGCTTCTAGGTGG - Intergenic
1001319904 5:170672047-170672069 TTCCCTAAGCTGCTTCTGGAAGG + Intronic
1006105763 6:31715391-31715413 TACCCAAGGCAGCCCCTAGCAGG - Exonic
1009464861 6:63956038-63956060 TTCTCAAGGCTGCTTCGAGCTGG - Intronic
1009501560 6:64420269-64420291 TTCCCTAGGCTGCATACAGCCGG + Intronic
1014114790 6:117659330-117659352 TTCTCTGGGCTGCTTCGAGCGGG + Intergenic
1021661075 7:22918427-22918449 TTCCCAGGGCTGCTTCTAGTGGG - Intergenic
1028690573 7:93645020-93645042 TTCTCAGGGCTGCTTCTAGCAGG - Intronic
1030233263 7:107230221-107230243 TAACCCAGTCTGCTTCTAACAGG - Intronic
1036252762 8:7176872-7176894 CACCCTAGGCTGCTCACAGCAGG + Intergenic
1036364736 8:8110590-8110612 CACCCTAGGCTGCTCACAGCAGG - Intergenic
1036893816 8:12614609-12614631 CACCCTAGGCTGCTCACAGCAGG + Intergenic
1037467028 8:19171158-19171180 TCCCCTGGGCTGCTTAAAGCAGG + Intergenic
1042040094 8:64580970-64580992 GCCCCTGGGCTGCTTCGAGCCGG + Exonic
1047581663 8:126223169-126223191 TACCCTAGGCTCCTTGCAGGAGG + Intergenic
1049018535 8:139938579-139938601 TAACATAGACTGTTTCTAGCTGG - Intronic
1051065870 9:13102384-13102406 TGCCTTAGGCTGCTTCTAGGAGG - Intergenic
1052218092 9:25990533-25990555 AACCCTAGGCTGCATACAGCAGG + Intergenic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1061360554 9:130139303-130139325 TTCCCTAGGGTGTTTCTGGCAGG + Exonic
1188431479 X:30108718-30108740 TTCTCAAGGCTGCTTCAAGCGGG - Intergenic
1201725107 Y:17142199-17142221 TTCTCAAGGCTGCTTCGAGCGGG + Intergenic