ID: 1121928940

View in Genome Browser
Species Human (GRCh38)
Location 14:97954538-97954560
Sequence AGCCAGCCTCAAGGATCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121928940_1121928946 18 Left 1121928940 14:97954538-97954560 CCTCGAGATCCTTGAGGCTGGCT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1121928946 14:97954579-97954601 CAAGCAAGAGGCACCTTCTGTGG 0: 1
1: 0
2: 1
3: 16
4: 181
1121928940_1121928947 19 Left 1121928940 14:97954538-97954560 CCTCGAGATCCTTGAGGCTGGCT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1121928947 14:97954580-97954602 AAGCAAGAGGCACCTTCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 151
1121928940_1121928943 -10 Left 1121928940 14:97954538-97954560 CCTCGAGATCCTTGAGGCTGGCT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1121928943 14:97954551-97954573 GAGGCTGGCTGGTCAACATGAGG 0: 1
1: 0
2: 1
3: 21
4: 210
1121928940_1121928944 6 Left 1121928940 14:97954538-97954560 CCTCGAGATCCTTGAGGCTGGCT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1121928944 14:97954567-97954589 CATGAGGATGACCAAGCAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121928940 Original CRISPR AGCCAGCCTCAAGGATCTCG AGG (reversed) Intronic
900001884 1:19024-19046 AGCCAGCCACAGGGATGTCTGGG - Intergenic
900021604 1:189547-189569 AGCCAGCCACAGGGATGTCTGGG - Intergenic
901178206 1:7320590-7320612 AGCCACCCTTAAGGATCTAAAGG - Intronic
902698316 1:18155097-18155119 AGCCAGTCACAAGGGTCTCCAGG + Intronic
904345688 1:29867275-29867297 AGCAAGCCCCAAGGATGTCTGGG - Intergenic
910450702 1:87341483-87341505 AGCAAGCTTCAAAAATCTCGGGG + Intronic
915474908 1:156147586-156147608 GGGCAGCCTCAGGGATCTTGAGG + Intronic
915977353 1:160400208-160400230 GGCCAGCCCCAGGGATCTGGGGG + Intergenic
920768375 1:208855486-208855508 TGCCAGTCTCAGGGATCTCCTGG + Intergenic
921211190 1:212900094-212900116 AGCCAGCCTCAGGGAGATGGGGG - Intergenic
922891787 1:229067407-229067429 TGCCAGCCTCCAGGTTCTCCAGG + Intergenic
923520897 1:234734391-234734413 AGCGAGCCACATGGATCTCCAGG + Intergenic
1065239659 10:23693674-23693696 ACTCAGCCTCAAGGATGTCTGGG + Intergenic
1067189431 10:44057174-44057196 AGCCAGCCTCGGGGACCTCCTGG - Intergenic
1076475435 10:130748546-130748568 AGCCTCCCCCAAGGATCTTGCGG + Intergenic
1077225878 11:1438945-1438967 ACCCAGCCTCAGGGAGCTCCTGG + Intronic
1077378763 11:2218103-2218125 AGACAGCCTCAGGGAGCTCTGGG - Intergenic
1077636352 11:3843943-3843965 ATCCAGCCTCAAAGATCTCATGG + Intergenic
1084065093 11:66699476-66699498 GGCCAGCCTCCAGGAGCCCGTGG + Exonic
1085383584 11:76142163-76142185 AGGGACCCTCAAGGACCTCGAGG + Exonic
1086250811 11:84811950-84811972 AGCCAGGCACAAGGGTGTCGTGG + Intronic
1088626841 11:111735706-111735728 AGCCAGCCTCAGGGCCCTCAGGG - Intronic
1088883908 11:113992582-113992604 ACCTGGCCTCAAGGATCTCAAGG + Intergenic
1091374964 12:19129-19151 AGCCAGCCACAGGGATGTCTGGG - Intergenic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1091698935 12:2647329-2647351 ATCCAGGCTCCAGGAACTCGGGG + Intronic
1103123968 12:118404966-118404988 AGCCAGCCTCCAGCATCTACTGG - Intronic
1103546402 12:121704787-121704809 AGCCAGCCTCAAAAACCTCAGGG + Intergenic
1105685161 13:22773676-22773698 AGCCTGCATCAAGAATCTCTTGG - Intergenic
1106591579 13:31103159-31103181 TCCCAGCCTCAAGAATCTCATGG + Intergenic
1111389857 13:87578966-87578988 AGCCAGCCCCTAGGAACACGGGG + Intergenic
1118702406 14:68446636-68446658 AGACAGCCACAAGGAGCTCCAGG - Intronic
1121928940 14:97954538-97954560 AGCCAGCCTCAAGGATCTCGAGG - Intronic
1122235439 14:100328596-100328618 GGCCAGCCTGCAGGGTCTCGGGG + Intronic
1124019186 15:25903916-25903938 CGCCAGCCTCAAGGATGTGAGGG + Intergenic
1131157582 15:90084619-90084641 AGCCAGCCTCAGGGATGGGGAGG + Intronic
1132451625 15:101971916-101971938 AGCCAGCCACAGGGATGTCTGGG + Intergenic
1132455264 16:18713-18735 AGCCAGCCACAGGGATGTCTGGG - Exonic
1134418149 16:14062390-14062412 ACCCAGCCTCCAGGATCTTTTGG + Intergenic
1135113036 16:19705427-19705449 AGCAAGCCTCAAAGAGCTCCAGG - Exonic
1136553903 16:30996904-30996926 GGGCAGCCTCAAGGAGTTCGGGG + Intronic
1137385795 16:48041482-48041504 AGCCAGCCTCAGGGTTCTGGGGG - Intergenic
1138535133 16:57655941-57655963 AGCCAACCTCACGGAGCCCGTGG + Exonic
1143329130 17:6121011-6121033 AGCCAGCCTCCAGGAGCACACGG - Exonic
1152249822 17:79206463-79206485 GGCCAGCCTCAACCATCTTGAGG - Intronic
1152532429 17:80926917-80926939 CACCAGCCTCAATGATCTCCTGG - Intronic
1152668117 17:81583538-81583560 AGCCAGCCTCACTCATCTCTGGG - Intronic
1155410102 18:25534403-25534425 AAGCAGCCTCCAGGATCTGGGGG - Intergenic
1159135818 18:64335623-64335645 AGCCAGCCTCAATGCCCTCCAGG - Intergenic
1160633636 19:60632-60654 AGCCAGCCACAGGGATGTCTGGG - Intergenic
1164599182 19:29549484-29549506 AGCCAGCGTCAGGGACCTCCTGG - Intronic
1164735575 19:30538663-30538685 AGGCAGCCTCCAGGATCTGATGG - Intronic
1166479162 19:43154926-43154948 AGCCAGCCTCCAGCATCCCAGGG + Intronic
1167729866 19:51245887-51245909 AGACAGCCTCTAGCATCTCAAGG + Intergenic
926223129 2:10949160-10949182 AGCCAGAGTCATGGACCTCGAGG - Intergenic
928001055 2:27523409-27523431 CGTCAGGCTCTAGGATCTCGAGG - Exonic
928373102 2:30755356-30755378 AGCCAGGCTCAGGAATCTCATGG - Intronic
933545891 2:83711473-83711495 AGCAATCCTAAAGGAGCTCGAGG + Intergenic
934852956 2:97712941-97712963 AGCCAGCCTGGAGGATGTCAGGG - Intergenic
936567838 2:113594383-113594405 AGCCAGCCACAGGGATGTCTGGG + Intergenic
944288841 2:197980921-197980943 AGCCAGCCTCAATGAGATCTGGG + Intronic
948094679 2:235324342-235324364 TGACAGCCTCAAAGAACTCGGGG - Intergenic
1170945685 20:20889204-20889226 AGCCACACTCAAGGATACCGAGG - Intergenic
1171164693 20:22959453-22959475 AGCCAGCCCCAAGAATTTCAGGG + Intergenic
1172633820 20:36395947-36395969 AGCCAGTCTCAGGGACCTCTGGG - Intronic
1175756412 20:61533190-61533212 AGCCAACCTCAAGGAGATGGAGG + Intronic
1176864615 21:14038881-14038903 ATCCAGACTCATGGGTCTCGGGG + Intergenic
1178643443 21:34365183-34365205 AACCAGCCTAAATGATCTCCAGG + Intronic
1179462809 21:41549055-41549077 ACCCAGCCCCATGGAGCTCGGGG + Intergenic
1181108781 22:20589667-20589689 GGCCAACCTCAAGGATTTGGGGG - Intergenic
1182570186 22:31231469-31231491 AGCCAGCCTTAATGATCTACGGG - Intronic
1183195229 22:36349086-36349108 AGCCAGCCTCAAGGAGGAGGTGG - Exonic
1184081093 22:42220775-42220797 AGCCAGCCTCAGTAACCTCGGGG - Intronic
1184758766 22:46533242-46533264 AGCCAGCCACAGGGCTCTCTGGG - Intronic
950622305 3:14215614-14215636 TGCCAGCCTAAAGGACCTCCTGG - Intergenic
961476511 3:127150144-127150166 AGCCAGCCCTTAGGATCTCCAGG - Intergenic
961511277 3:127405282-127405304 AGCCACACTCAAGGAGCTCCAGG + Intergenic
962263396 3:133928764-133928786 AGCCAGCCTCAAGACCCTCCAGG + Exonic
964222974 3:154367809-154367831 AGCCAGCCAGGAGGATCTCCAGG + Intronic
965844107 3:172941191-172941213 AAGCAGCCTCAATGATCTGGAGG + Intronic
967830070 3:193911119-193911141 AGTCAGACTCAAGGCTCTGGGGG - Intergenic
968229936 3:196999582-196999604 AGCCAGCTTCCAGGGTCTGGAGG - Intronic
968646647 4:1744422-1744444 AGACAGCCTCGAGGATCTGCAGG + Intronic
975004244 4:69267647-69267669 AGCCAGCCAGGAGGATCTCCAGG + Intergenic
981911953 4:149992275-149992297 AGGCAGCCTCTAGGATCTGAAGG + Intergenic
985606846 5:862414-862436 AGCCAGTCTCGGGGACCTCGGGG + Intronic
990795392 5:59534438-59534460 AGACAGCCTCAAGGATCTGGTGG + Intronic
1003233489 6:4275509-4275531 AGCCAGAGTCAAGGAGCACGTGG - Intergenic
1004691106 6:17992794-17992816 AGCCAGCCTCAAGTATCTGAGGG - Intergenic
1015939076 6:138431183-138431205 AGGCGGCCTCAAGGATCCCCGGG + Exonic
1018176706 6:161183828-161183850 AGCCAGCCTCGTGGCTCTCTGGG + Intronic
1024896603 7:54268245-54268267 AGCCAGGCTGACGGAGCTCGAGG + Intergenic
1029978153 7:104853029-104853051 ACCCATCCTGAAGCATCTCGGGG + Intronic
1031446237 7:121858124-121858146 AGCCAGCCACAAGGGTCTCTGGG + Intergenic
1032535246 7:132657668-132657690 AGCCAGCCTCCAGGAAGTGGAGG - Intronic
1033022389 7:137739498-137739520 AGGAAGCCGCTAGGATCTCGAGG - Intronic
1036963939 8:13275894-13275916 AGACAGCCCCGAGGATCTCAGGG + Intronic
1039205666 8:35151331-35151353 AAACAGCCTCAAGGATCCCATGG - Intergenic
1039612808 8:38932725-38932747 ATCAAGCCTCAAGGATCCTGGGG + Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1049690855 8:143958241-143958263 AGCCAGCCTGCAGGATTTCTGGG + Intronic
1049884692 9:19137-19159 AGCCAGCCACAGGGATGTCTGGG - Intergenic
1053184861 9:36007173-36007195 CTTCAGCCTCAAGGATCTGGTGG + Intergenic
1053785528 9:41650094-41650116 ACCTAGCCTCCAGGATCTCTAGG - Intergenic
1054159503 9:61664079-61664101 ACCTAGCCTCCAGGATCTCTAGG + Intergenic
1054174248 9:61864046-61864068 ACCTAGCCTCCAGGATCTCTAGG - Intergenic
1054449106 9:65393113-65393135 ACCTAGCCTCCAGGATCTCTAGG - Intergenic
1054479277 9:65595082-65595104 ACCTAGCCTCCAGGATCTCTAGG + Intergenic
1054663290 9:67716735-67716757 ACCTAGCCTCCAGGATCTCTAGG + Intergenic
1056068162 9:82958410-82958432 AGCCAGACTCCAGCATCTCAGGG + Intergenic
1056795291 9:89654976-89654998 AGCCAGCTCCAGGGCTCTCGGGG - Intergenic
1061226484 9:129283716-129283738 CGCCACCCTCCAGGATCTCCTGG + Intergenic
1061302078 9:129711133-129711155 AGCCAGCCCCAAGATCCTCGTGG - Intronic
1061886575 9:133593950-133593972 AGCCAGCCCCATGGATCTGGGGG - Intergenic
1190372000 X:49751732-49751754 AGCCAGCATCAAGGAGTTCCAGG + Intergenic
1190693410 X:52931506-52931528 AACCAGGCTCAGGGATCTCCTGG + Intronic
1192188593 X:68976347-68976369 AGGGAGCCTCAAGGAACTTGTGG - Intergenic
1193216284 X:78868154-78868176 AGGCTGCCTCAAGGATCCTGAGG - Intergenic
1193462987 X:81811788-81811810 AGCCAGCCAGGAGGATCTCCAGG - Intergenic
1198277780 X:135112740-135112762 ACCCAACCCCAAGGATCTGGAGG - Intergenic
1200401115 X:156021015-156021037 AGCCAGCCACAGGGATGTCTGGG + Intergenic
1201730163 Y:17193733-17193755 AGCCAGCATCAAGGATTGAGAGG - Intergenic
1201750277 Y:17423802-17423824 AGCCAGCCAGGAGGATCTCCAGG - Intergenic