ID: 1121931713

View in Genome Browser
Species Human (GRCh38)
Location 14:97978219-97978241
Sequence GAGAGTTGCAGGGAAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121931709_1121931713 -6 Left 1121931709 14:97978202-97978224 CCAAGATTTGGCAACCAGAGAGT 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG 0: 1
1: 1
2: 1
3: 29
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121931713 Original CRISPR GAGAGTTGCAGGGAAGCAGC AGG Intergenic
900389292 1:2427128-2427150 CAGGGTAGCAGGGAAGTAGCAGG + Intronic
900562664 1:3315165-3315187 GAGGGTGGGAGGGAAGCAGGGGG - Intronic
900695436 1:4006592-4006614 GGAAGCTGCAGGGAAGCATCAGG - Intergenic
902227632 1:15006758-15006780 GAAAGTTCCAGGGAAGGGGCTGG + Intronic
902420159 1:16272552-16272574 GAGAGTTGCAGTGACCCACCGGG - Intronic
903002635 1:20277122-20277144 GAGAGGTGAAGGGAAGTAGGAGG - Intergenic
903258546 1:22118701-22118723 AAAAGGGGCAGGGAAGCAGCAGG - Exonic
903269112 1:22176778-22176800 GAGAGAGGCTGGGAGGCAGCAGG + Intergenic
903359167 1:22766138-22766160 GAGCTTTGAAGGGAGGCAGCCGG + Intronic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
903943741 1:26949164-26949186 GAGAGTGGAAGGGGAGCAGCAGG + Intergenic
903958840 1:27043762-27043784 GAGAGTGACAGTGACGCAGCTGG - Intergenic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904169472 1:28581565-28581587 GAGTGTTGCAGGCAGGCGGCCGG - Intergenic
906149385 1:43578653-43578675 GAGAGCTTCCTGGAAGCAGCAGG + Intronic
906490738 1:46266594-46266616 GAGATGTGAAGGGAAGCAGAGGG + Intronic
908681017 1:66660951-66660973 GGGAGTTGTAGGGAAGCTGGGGG + Intronic
909181923 1:72435236-72435258 GGGAGAGGCAGTGAAGCAGCAGG - Intergenic
911144661 1:94541334-94541356 GGGAGTTGCAGGGAGGGAGTTGG - Intronic
913539759 1:119807539-119807561 AAGAGTGGCAGGGAACCACCTGG + Intronic
915011267 1:152688154-152688176 GAGAGAAGCAGGGAAACAGCAGG + Intergenic
915475559 1:156150808-156150830 AAGGGTTGCAGGGGAGGAGCTGG + Intronic
916261983 1:162851384-162851406 AAGAGTACCAGGGAAGCAGAGGG - Intronic
916742999 1:167662583-167662605 GAGAGTTTCTGGAAAGCAGATGG - Intronic
918134702 1:181661321-181661343 GGGAGAAGCAGAGAAGCAGCGGG + Intronic
919986690 1:202680681-202680703 GAGAGGGGCAAGGAAGAAGCTGG - Intronic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
920715001 1:208331889-208331911 GACAGCGGGAGGGAAGCAGCAGG - Intergenic
922204986 1:223438275-223438297 TAGAGTTGCAGGAAAGAAGATGG - Intergenic
923215959 1:231847964-231847986 GAGAGCTGCTGGGAAGAATCTGG + Intronic
1062903794 10:1166257-1166279 GAGAGGACCAGGGGAGCAGCGGG + Intergenic
1062963042 10:1588210-1588232 GAGTGTTTCAGGGCAGCAACTGG - Intronic
1063379301 10:5574449-5574471 GAGAGGTGCAGAGAGGCTGCGGG + Intergenic
1063566324 10:7174626-7174648 GGGAATGGCAGGGAAGGAGCAGG - Intronic
1065577369 10:27135643-27135665 GAGAGGAGCAGGGAAACAGAGGG + Intronic
1066322104 10:34313749-34313771 GGGAGTTGCAGGGAGGCAACAGG + Intronic
1066482035 10:35806045-35806067 TAATGTTGCAGAGAAGCAGCAGG + Intergenic
1067038110 10:42933851-42933873 GCGGGGTGCAGGGAAGCCGCAGG - Intergenic
1068616508 10:59124236-59124258 GAGAGTAGGAGGGAGGCAGTGGG - Intergenic
1069632931 10:69908472-69908494 AGGAGTTGCAGGGCAGCAGAGGG + Intronic
1070728641 10:78809428-78809450 GAGATTTGCAGCCAATCAGCTGG + Intergenic
1071489004 10:86123302-86123324 GAGAGTGGAGGGGAAGCAGTTGG + Intronic
1071968852 10:90882114-90882136 GAGAGTTGCATAGAAGCTTCTGG + Intronic
1073215617 10:101834471-101834493 GAGAGTGGGAGGGAGGCTGCAGG - Intronic
1073216861 10:101841212-101841234 CAGGCTTGCAGGGAAGCAGCTGG - Intronic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1074322013 10:112412087-112412109 GAGAGGTGCAGGCAAGGAGTTGG + Intronic
1074921392 10:118017564-118017586 GAGACTGGCAGCGAGGCAGCAGG + Intronic
1075426945 10:122349408-122349430 GAGAGTGGTAGGGAAGGAGGGGG - Intergenic
1076837333 10:133027725-133027747 GGGCCTTGCAGGGAGGCAGCCGG + Intergenic
1077519272 11:3022128-3022150 TAGAGCTGCAGGGAAGCGGATGG - Intronic
1077847164 11:6038402-6038424 GGGAGTTCCACCGAAGCAGCAGG - Intergenic
1077852414 11:6085745-6085767 GAGATTTGTAGGGAAGGGGCTGG - Intergenic
1078523232 11:12080400-12080422 GTGAGTTGCGGGGGGGCAGCGGG + Intergenic
1078719501 11:13871455-13871477 CAGAAGTGCACGGAAGCAGCTGG - Intergenic
1078867099 11:15307844-15307866 AAGAGCTACAGGGAAGCAGCAGG + Intergenic
1080044590 11:27796099-27796121 GGGAGAAGCAGGGAAGCAACAGG + Intergenic
1080822965 11:35824595-35824617 GTGAGGTGGAGGGAAGCAGAAGG - Intergenic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1081553972 11:44140367-44140389 GAGAGTTTCATGGAAACACCAGG + Intronic
1081689713 11:45069633-45069655 GCCAGTTTCAGGCAAGCAGCAGG - Intergenic
1083425258 11:62581077-62581099 GAGTGTCCCAGGGAGGCAGCTGG - Intronic
1083433955 11:62630135-62630157 GAGAGATTCAGGGAGGCAGGTGG + Intronic
1083885722 11:65572621-65572643 GAGCGTTGGAGGGAAGGAGGTGG + Exonic
1084411472 11:69008610-69008632 GAGAATGGCAGGGAGGGAGCAGG - Intronic
1085038992 11:73315921-73315943 GAGGGTGGGAGGGAAGCAGGAGG - Intronic
1086942982 11:92817138-92817160 GAGATAAGCAGGGCAGCAGCTGG + Intronic
1089103207 11:115981492-115981514 GACAGTTGCAGGGAAACAAAGGG + Intergenic
1089191788 11:116659124-116659146 GAGAGTCCCAGGGAGGCAGAGGG - Intergenic
1090243156 11:125197986-125198008 GACCAATGCAGGGAAGCAGCTGG + Intronic
1090736739 11:129617469-129617491 GAGAGTGGCAGGGCAGGAGGAGG - Intergenic
1090846099 11:130531236-130531258 GAGAGTTAAGGGGAAGCAGGTGG + Intergenic
1091949587 12:4581734-4581756 GAGAGAGGCAGGGAGGGAGCAGG - Intronic
1093831198 12:23760666-23760688 GAGAGTTATAGGGAATGAGCAGG - Intronic
1095313831 12:40733968-40733990 GAGAGTTGCAGGGAAAACCCAGG - Intronic
1096788621 12:54031747-54031769 GAGATTTCCTGGGAAGAAGCAGG + Intronic
1101212494 12:102548637-102548659 GGGAGTTTCAAGGAAGCAGTGGG + Intergenic
1101234827 12:102777907-102777929 AAGTGTTGCAGGAAAGGAGCAGG - Intergenic
1101542429 12:105677038-105677060 GGGAGAAGCAAGGAAGCAGCAGG + Intergenic
1102547057 12:113664825-113664847 GTGAATTTCAGGGAAGCGGCAGG - Intergenic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1104302850 12:127581364-127581386 CAGAGTGGCAGAGAAGCAGTGGG + Intergenic
1104393887 12:128415182-128415204 GAGAGGTGCGGGGCAGCTGCCGG + Exonic
1104544688 12:129700226-129700248 GAGAGGTGCGGGGCAGCTGCCGG - Exonic
1105404072 13:20119066-20119088 GGGACCAGCAGGGAAGCAGCTGG + Intergenic
1107875083 13:44783273-44783295 GAGAGGAGAAGAGAAGCAGCTGG - Intergenic
1108795396 13:54024057-54024079 GAGAGTTGCAGATAAGCTACTGG - Intergenic
1109039254 13:57310853-57310875 GAGAGAAGCAGAGAAGCAGCTGG + Intergenic
1109624799 13:64960689-64960711 GATATTTTCATGGAAGCAGCAGG - Intergenic
1110667098 13:78129821-78129843 GAGAGCTGGAGGGAAGAGGCAGG - Intergenic
1112477038 13:99740894-99740916 GAGAATTCCAGGAAAGCATCAGG + Intronic
1113557362 13:111249133-111249155 CAGAGTTGCTGGGAAGCTGGGGG - Intronic
1114066380 14:19062504-19062526 GGGAGAGGCAGGGAAGGAGCCGG - Intergenic
1114095888 14:19337520-19337542 GGGAGAGGCAGGGAAGGAGCCGG + Intergenic
1114487262 14:23070225-23070247 GGGAGCTGCAGGGAAGAAGCAGG + Intronic
1116785220 14:49280744-49280766 GAGATTAGCAGGGAAGCACTGGG - Intergenic
1118730585 14:68663210-68663232 GAGAGTTGCTTGAAACCAGCAGG + Intronic
1118820950 14:69345571-69345593 GGGAGTTACAGGGGAGCAGGAGG - Intronic
1119075288 14:71632193-71632215 GAAAGGTGGAGAGAAGCAGCAGG + Intronic
1119148508 14:72337383-72337405 AGGAGTTGCAGGGAACCAGGAGG - Intronic
1119982321 14:79096059-79096081 GAGAGAGGCAGGGAAGGAGGAGG - Intronic
1120370320 14:83626006-83626028 GAGGGTTGCAGTGAGGCAGTGGG + Intergenic
1120382057 14:83793233-83793255 GAGAGAAGCAGGGAAGGAGTGGG - Intergenic
1120513664 14:85445307-85445329 AAGAGTTCAAGGGAAGCATCAGG + Intergenic
1121446505 14:93982303-93982325 GAGAGTTGCAGGGCTATAGCTGG - Intergenic
1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG + Intergenic
1122250657 14:100437143-100437165 GAGAGTGGCAGGAAAGGAGGAGG + Intronic
1122288030 14:100664277-100664299 GAGAGTGGGGGGGAAGCAGGAGG - Intergenic
1122616559 14:103021987-103022009 CTGAGTGGCAGGGAAGCAGCTGG + Intronic
1123034254 14:105465458-105465480 GAGACTGGCAGGGAAGCCCCCGG - Intronic
1126365062 15:47885969-47885991 CAGAGTTACAAGGAAGCAGAGGG - Intergenic
1126583914 15:50264781-50264803 GAGGGTTGAAGGGGAGCAGAAGG - Intronic
1127067772 15:55258127-55258149 GAGAGGTGCAGAGAAGGAGCTGG - Intronic
1128716767 15:69914297-69914319 GAGGGCTGCAGGGCAGGAGCAGG - Intergenic
1128758051 15:70196487-70196509 GAGAGTTCCTGGGGAGGAGCTGG + Intergenic
1130693921 15:86111090-86111112 GAGAATTGCCTGGAGGCAGCTGG + Intergenic
1130881308 15:88058207-88058229 CAGAGTGGCAGGTAAGCACCAGG + Intronic
1130940762 15:88506870-88506892 GAGAGGTTCAGGGAAGAATCTGG + Intergenic
1131749940 15:95495428-95495450 GAGAGCTGGAGGAAAGCAGGAGG + Intergenic
1134675152 16:16085216-16085238 GGGGGTTGCTGTGAAGCAGCAGG - Intronic
1135862969 16:26074181-26074203 GAAAGCTGCAGGGAAGCTACAGG - Intronic
1135990507 16:27216079-27216101 GTGAGTAGGAGGGAGGCAGCAGG + Intronic
1136047359 16:27625003-27625025 GAGGGTGGCAGGGCAGCAGGAGG + Intronic
1136578477 16:31138473-31138495 GGGAGGTGCAGGTAAGCAGTGGG + Intergenic
1137720485 16:50624879-50624901 CACAGCTGCAGGGAAACAGCTGG + Intronic
1138659357 16:58508479-58508501 CAGAGCTGCTGGGAAGCTGCAGG + Intronic
1139019867 16:62734831-62734853 GTGAGTTGCAGAGAAGCAAAAGG + Intergenic
1139369117 16:66454860-66454882 AACAGTAGCAGGGAAGCTGCTGG + Intronic
1139529613 16:67536681-67536703 GAGAGATGCAGAGAAGGAACTGG - Intronic
1140137641 16:72221914-72221936 GAGAGATACAGGGAAGAGGCTGG - Intergenic
1141086742 16:81101189-81101211 GAGAGGAGCCTGGAAGCAGCAGG - Intergenic
1141279347 16:82616880-82616902 GATAATTCCAAGGAAGCAGCAGG + Intergenic
1141755454 16:85987787-85987809 GGGAGGAGCAGGGAAGAAGCCGG - Intergenic
1142066143 16:88064190-88064212 GAGAGGCGCAGGGGAGCAGGGGG + Intronic
1142359199 16:89618916-89618938 GGGAGCTGCAGGGAGGGAGCAGG - Intronic
1142500077 17:327410-327432 GAGAGGAGCAGGGAGGCAGAAGG + Intronic
1144827208 17:18112198-18112220 GAGACTTGCTGGGGAGAAGCAGG - Intronic
1144859574 17:18292400-18292422 AGGACTAGCAGGGAAGCAGCAGG + Intronic
1145239483 17:21231796-21231818 GAGAGTGGCAAGGAGGCATCAGG + Intergenic
1146133194 17:30295926-30295948 TAGAGTGGCATGGAAGCAACAGG - Intergenic
1147036582 17:37686136-37686158 GTGAGTTGCAGGGAAGAAAAGGG + Intergenic
1147757365 17:42777931-42777953 GAGACCTGCAGGGCAGCAGGGGG - Intronic
1147910364 17:43852657-43852679 AAGGGTGGCAGGGAAGAAGCAGG + Intronic
1148564862 17:48626733-48626755 GAGAGGCGGAGGGAAGCGGCGGG + Intronic
1149518973 17:57303985-57304007 GAGTCTTGGAGGGAAGGAGCAGG + Intronic
1150808610 17:68338424-68338446 GAAAGTTGAAGGGAAGGGGCAGG - Intronic
1151417219 17:73974266-73974288 GAGCGTGGAAGGGGAGCAGCTGG - Intergenic
1151448383 17:74182020-74182042 GGGGGTTGCAGGGAAACAGGAGG - Intergenic
1151752825 17:76050826-76050848 AAGCGCTGCAGGGAAGTAGCAGG - Intronic
1152015827 17:77749631-77749653 GAGACCTGCAGCGAAGCAGAGGG - Intergenic
1152210433 17:79000415-79000437 GAGGGGTGGAGGGAGGCAGCCGG - Intronic
1152812810 17:82390400-82390422 GAGAGTGTCCGTGAAGCAGCCGG + Intronic
1152920121 17:83062326-83062348 GTGGGGTTCAGGGAAGCAGCTGG - Intergenic
1153228348 18:2914372-2914394 GATTGGTGCAGTGAAGCAGCAGG - Exonic
1153456931 18:5293450-5293472 GAGAGTGGCAGGTAGGTAGCTGG + Intronic
1154278923 18:12983065-12983087 GGGAGCTGCAGAGAAGAAGCAGG - Intronic
1154981152 18:21503532-21503554 GACAGTTGCAGGCACGCAGCTGG - Intronic
1154981204 18:21503903-21503925 GACAGTTGCAGGCACACAGCTGG - Intronic
1155916676 18:31564502-31564524 GAGAGTTCAAGGAAAGCAGCGGG - Intergenic
1157180710 18:45495648-45495670 GAGAGGTCCAGGGAAGAAGGGGG - Intronic
1160222916 18:76990277-76990299 GAGATTTGTAGCAAAGCAGCAGG + Intronic
1163109696 19:15152134-15152156 GAGAGTTACAGGGAACCAGTTGG + Intergenic
1164583743 19:29452158-29452180 GAGAGTTCCAGGGAATCTGGAGG - Intergenic
1164875057 19:31678880-31678902 GAGAACAGCAGGGCAGCAGCAGG + Intergenic
1165491882 19:36128273-36128295 TAGAGATGCAGGAAAGCAGGAGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166644328 19:44519950-44519972 GAGACTTGAATGGAAGCACCTGG - Intronic
1166742781 19:45124304-45124326 GTGAGGTGCTGGGAAGCACCGGG + Intronic
1167108612 19:47446055-47446077 GAGAGATGCAGAGATGCAGAGGG + Intronic
926283279 2:11467281-11467303 CAGAGTTGGAGGGAAACAACTGG + Intergenic
927971555 2:27308675-27308697 GATAGCTGCAGGGAGGCAGTGGG - Intergenic
928068843 2:28194225-28194247 GAGAGCTGCAGGGAGCCATCTGG + Intronic
929794774 2:45050571-45050593 GAGGGATGCAGGGTAGCAGTAGG - Intergenic
931284885 2:60823721-60823743 TAATGTTGCAGGCAAGCAGCAGG + Intergenic
933300695 2:80537681-80537703 GAGAGTTGCTTGAAACCAGCAGG - Intronic
934112705 2:88757426-88757448 GAGAGATGCTGGGAACCACCTGG - Intergenic
934856368 2:97732760-97732782 GAGCCTTGCAGAGAAGCTGCAGG - Intronic
936163913 2:110103887-110103909 GAGAGATGCTGGGAACCACCTGG - Intronic
937217830 2:120323869-120323891 GTGAGGAGCAGGGAGGCAGCTGG - Intergenic
937223693 2:120356386-120356408 GAGAGCTGCAGGGCAGCTGAGGG - Intergenic
937293583 2:120796596-120796618 GAGGGTTGCAGGGGCACAGCGGG - Intronic
937479234 2:122241736-122241758 GAGACCTGCAGGAAAGCATCTGG - Intergenic
938483772 2:131682637-131682659 GGGAGAGGCAGGGAAGGAGCAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938954026 2:136282178-136282200 GAGAGTCCCAGGGAAGAAGGAGG + Intergenic
938981172 2:136528690-136528712 GAGAGGTGGAGGGAAGTTGCTGG - Intergenic
939790965 2:146576584-146576606 GAGTGTTGTCTGGAAGCAGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942550815 2:177116762-177116784 GATAGTTTCAGGGAAGGAGAGGG + Intergenic
943792387 2:191948053-191948075 GAGAGTTGCAGGAAGGCTGTGGG + Intergenic
947699060 2:232217323-232217345 GATTGTTGCAGGGTGGCAGCAGG - Intronic
948043963 2:234928531-234928553 GAGAGCTGGAGAGGAGCAGCTGG + Intergenic
948262597 2:236615167-236615189 GGCAGCTGCAGGGAAGCAGCAGG - Intergenic
1168760558 20:347283-347305 GGGGGTCCCAGGGAAGCAGCAGG + Intronic
1168837751 20:888967-888989 GAGAGTGGCAGGCAAGGAGCTGG - Intronic
1168984005 20:2032068-2032090 GTGAGCAGCAGGGAAACAGCAGG - Intergenic
1169030867 20:2405871-2405893 GAGAATTGAAGGGAGACAGCAGG - Intronic
1170012167 20:11736091-11736113 GAGAGTTCTTGGGAAGCAGGTGG - Intergenic
1170899246 20:20444564-20444586 GAGAGTGTCTGGAAAGCAGCAGG - Intronic
1171970172 20:31559566-31559588 GAGAGTGGCAGGGAAGCAGCAGG - Intronic
1172098623 20:32472918-32472940 GAGAGATGCAGGGAGGCTGGGGG - Intronic
1173786433 20:45796512-45796534 CAGAGAGGCAGGGAGGCAGCAGG - Intronic
1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG + Intergenic
1174567845 20:51479860-51479882 GAGGGTGGCAGGGAAGCGGGTGG - Intronic
1174588664 20:51627853-51627875 GGAAGTTGCAGAGAGGCAGCCGG + Intronic
1174927337 20:54774715-54774737 GAGAGATGCAAGGGAGAAGCAGG - Intergenic
1175108455 20:56630171-56630193 GAGAGTGGGAGGGAAGAAGGAGG + Intronic
1175499825 20:59441871-59441893 GAGAGTGGCAGTGACTCAGCCGG + Intergenic
1175660970 20:60811725-60811747 GAGGGGTATAGGGAAGCAGCAGG - Intergenic
1177145045 21:17398272-17398294 GTGAGTTGCAGGGAAAGGGCAGG + Intergenic
1177234422 21:18368528-18368550 GAGAGTGGCAAGTAAGGAGCAGG + Intronic
1179783648 21:43718273-43718295 GGGTGGTGCAGGGAAGCCGCAGG + Intergenic
1180061455 21:45387241-45387263 GAGAGCTGCATGGAAGCTCCTGG - Intergenic
1180484858 22:15785095-15785117 GGGAGAGGCAGGGAAGGAGCCGG - Intergenic
1180974235 22:19837958-19837980 GAGAGGTGCAGGGAGGAAGAAGG + Intronic
1181040160 22:20188273-20188295 CAGAGTGTCAGGGAAGCAGTGGG + Intergenic
1181595823 22:23913860-23913882 GGGAGCTGCAGGGAAGGGGCGGG - Intergenic
1181672522 22:24432390-24432412 GAGAGTTGACGGGATGGAGCAGG + Intronic
1181901248 22:26157961-26157983 GAGAAATGCAGGGGAGCAGGTGG - Intergenic
1182537179 22:31013252-31013274 GAGAGTTGCTTGGATGTAGCTGG - Intergenic
1183016145 22:34989266-34989288 GAGAGGAGAAAGGAAGCAGCAGG - Intergenic
1184493195 22:44822294-44822316 GAGGGTTGCAGGGAGGGAGGGGG - Intronic
1184515314 22:44958254-44958276 GAGAGAGTCAGGGAGGCAGCAGG - Intronic
1184649538 22:45913262-45913284 GAGAGTGCCTGGGTAGCAGCAGG - Intergenic
1185251391 22:49803651-49803673 GAGAGTGGGAGGGAAGGAGCAGG - Intronic
949661285 3:6282093-6282115 GTGGGTTGGAGGCAAGCAGCAGG + Intergenic
950451724 3:13069235-13069257 GAGAGATGCAGGGAGGGAACCGG - Intronic
951810357 3:26691986-26692008 GAGAGCTGCAGAGAATCAACAGG + Intronic
952737839 3:36707702-36707724 TAGAGTGACAAGGAAGCAGCAGG + Intergenic
952882423 3:37993056-37993078 GAGTGGTGCAGGGAAGCCTCAGG + Intronic
953221863 3:40979125-40979147 GGGAGTTGCAGGCAAGTTGCAGG - Intergenic
953564836 3:44022339-44022361 GACAGTTGCAGAAAAGCGGCCGG - Intergenic
953777911 3:45838848-45838870 AAGAGTTGAAGGGAAGCAAAAGG + Intronic
954422471 3:50425952-50425974 GGGGGTTGCTGGGGAGCAGCTGG - Intronic
955409263 3:58645302-58645324 GAGAGATGCTGTGAAGCACCAGG + Intronic
955770235 3:62378153-62378175 GAGAGCTGGAGGGAAGAAGGAGG - Intergenic
956279955 3:67545771-67545793 AAGTATTGCAGGGAAGCAGGTGG - Intronic
956376337 3:68617230-68617252 GATAGATGCTGGGAAACAGCTGG + Intergenic
956760489 3:72439161-72439183 TAGAGATGCCAGGAAGCAGCTGG + Intronic
958045602 3:88280384-88280406 AAGAGCAGCAAGGAAGCAGCAGG + Intergenic
958753083 3:98216073-98216095 GAGTGTTGAAGGGAAGAAGTGGG - Intergenic
959596795 3:108137367-108137389 GAGAGGGGCAGGGCAGCAACAGG + Intergenic
960675554 3:120191163-120191185 GAGAATTGCTGGAAAGCAGAAGG + Intronic
960897294 3:122518944-122518966 GACAGTTTCAGAGAACCAGCAGG + Intergenic
960997330 3:123348775-123348797 GAGCCTGGCAGGGAGGCAGCTGG - Intronic
961413919 3:126743748-126743770 GAGAGTGGCATTGGAGCAGCAGG + Intronic
961722662 3:128906999-128907021 GTGAGTTGCAGGGATGAGGCCGG + Intronic
964634037 3:158841649-158841671 CAGAGATGCAGGTCAGCAGCAGG + Intergenic
968438186 4:606421-606443 GAAAGTTCAAGGGAGGCAGCAGG + Intergenic
968645858 4:1740162-1740184 GCGAGTTGCGGGGAAGCTGGTGG + Intronic
968652673 4:1766431-1766453 GAGGGTTGCCGGGACTCAGCAGG - Intergenic
968687197 4:1969137-1969159 GAGAGTTGAAAGGGAGCAGTGGG + Intronic
969367896 4:6710002-6710024 GAGGGGCGCCGGGAAGCAGCTGG - Intergenic
970585918 4:17514131-17514153 GAGAGTGTCAAGGAAGCAGAGGG - Intergenic
971012851 4:22458293-22458315 GGGAGTTGAGGGGCAGCAGCAGG - Intronic
972479659 4:39485520-39485542 AAGAGTGGCAGGGAAGCAATTGG + Intergenic
972996647 4:44887407-44887429 AAGAGTTGCAGGGTAGTAGGGGG - Intergenic
973806010 4:54526940-54526962 CAGAGTTGCCGGGAAGGGGCTGG - Intergenic
973981965 4:56314887-56314909 GAGAGCAGCAGGGAAGGAGCGGG + Exonic
974031921 4:56784100-56784122 GAGAGGAGCAGGGAAGTGGCAGG - Intergenic
976632746 4:87255794-87255816 GGGAGTGGCAAGGAAGCATCTGG - Intergenic
977332996 4:95661592-95661614 GAGAAGTGCAGGGAAGAAGTTGG + Intergenic
977637059 4:99311577-99311599 GAGAGGTTCTGGGAAGCAGGAGG + Exonic
981555167 4:145985126-145985148 GAGAGTTGTGTGGAAGCAACAGG + Intergenic
981747451 4:148065230-148065252 AAGAGTTCCAGGGAAGCAGTAGG + Intronic
982405552 4:155015996-155016018 CTGAGTTGCAGAGATGCAGCAGG + Intergenic
984007609 4:174332162-174332184 GAAAGTAGCAGGGAAAGAGCTGG + Exonic
984156661 4:176202969-176202991 GAGAGTCCCAGGAAAGCAGAGGG + Intergenic
984268024 4:177517268-177517290 TAGAATTGTAGGGAAGCAGCAGG - Intergenic
984624998 4:181996866-181996888 GAGACTGTCTGGGAAGCAGCTGG + Intergenic
985150327 4:186940700-186940722 AAGAGGTACAGGGAAGCCGCTGG - Intergenic
985487522 5:159812-159834 GAGTGTCGGAGGGAAGGAGCTGG - Intronic
985552092 5:538892-538914 GAGAGAGTCAAGGAAGCAGCCGG + Intergenic
985773944 5:1830802-1830824 GAGAGTGGGAGGGAAGGAGAGGG - Intergenic
985852714 5:2400404-2400426 GAGAGTAGCAGGGCTGCAGCAGG - Intergenic
986306192 5:6518811-6518833 AATAGTGCCAGGGAAGCAGCGGG - Intergenic
986421723 5:7591639-7591661 GAGAGTTAGAGGGAAGAAGTGGG + Intronic
986589730 5:9356081-9356103 AAGAATTGAAGGGAAGGAGCAGG - Intronic
986805177 5:11302307-11302329 GAGAGATCCAGGGAATCAGAGGG + Intronic
988640110 5:33032512-33032534 GAGAGTAGGAGGGAAACAGAGGG - Intergenic
988999341 5:36744673-36744695 GGGAGCTCCCGGGAAGCAGCGGG - Intergenic
995036076 5:107535980-107536002 GAGGATTCCAGGGAATCAGCAGG - Intronic
995386425 5:111594760-111594782 GAGAAATGCAGGGAAGAACCAGG + Intergenic
995580390 5:113594227-113594249 GAGAAATGCAGGAAAGGAGCGGG - Exonic
997523536 5:134538372-134538394 GAGAGTTGCAGTCATCCAGCAGG + Intronic
997852626 5:137346313-137346335 GAGGGGTGCAGGGAAGGAGGGGG - Intronic
998578921 5:143349608-143349630 GAAAGCTGCAGGAAAGCAGCAGG - Intronic
999763580 5:154721533-154721555 GAAAGGAGCTGGGAAGCAGCTGG + Intronic
999817618 5:155193108-155193130 GAGAGGAGCAGGGAAGCGGGTGG + Intergenic
999925267 5:156369034-156369056 GAGAATTACAGGGAATCATCTGG - Intronic
1000326333 5:160175445-160175467 GAGAGGTGCGGGAAGGCAGCTGG + Intergenic
1001024994 5:168216523-168216545 GTCAGTTGCAGGGAAGAAGGTGG + Intronic
1001519682 5:172382097-172382119 GAGAGATGTAGGGGGGCAGCTGG + Exonic
1001825013 5:174737502-174737524 GAGAATTCCAGGAAAGCAACTGG + Intergenic
1002000030 5:176192201-176192223 CAGCGTTCCAGGGAAGCACCTGG - Intergenic
1002453021 5:179330454-179330476 GGCAGTTGCAGGGAGGCTGCTGG - Intronic
1003137353 6:3443976-3443998 GAAAGATGCAGGGCAGCAGGTGG - Intronic
1003298641 6:4856525-4856547 GAGGGTGGCAGGGTAGAAGCAGG + Intronic
1003410924 6:5862362-5862384 GAGAGTGGGAGGGGAGAAGCTGG + Intergenic
1004011483 6:11692524-11692546 GAGAGCTCCAGTGAAGCAGAAGG + Intergenic
1004186131 6:13422763-13422785 GAAAGCTGCAGGGAACCAGAGGG + Intronic
1004469920 6:15920178-15920200 GGGAGCTGCAGGGAGGAAGCCGG + Intergenic
1005348986 6:24915896-24915918 CAGAGTGGCGGGGATGCAGCTGG - Intronic
1005495445 6:26383828-26383850 GAGAAGTGCAGAGCAGCAGCTGG - Exonic
1005500130 6:26422125-26422147 GAGAAGTGCAGGGCAGCAGCTGG - Intergenic
1005910067 6:30301865-30301887 GGGAGGTGCAGGGCAGCAGGGGG - Intergenic
1007426283 6:41748383-41748405 GACAGAAGCAGGGACGCAGCGGG - Intronic
1008082444 6:47208632-47208654 GAGAGTTTCAAGGAAGCAAGAGG - Intergenic
1009466416 6:63975627-63975649 GAGGGTTACAGTGAAGCAGCTGG + Intronic
1010426594 6:75734760-75734782 GAGAGGTGGAGGGAAGGAGAAGG + Intergenic
1010773551 6:79860033-79860055 AGGAGTTGCATGGAGGCAGCTGG - Intergenic
1010851405 6:80782212-80782234 GAGTGTTGAAGGGAAGAAGCCGG - Intergenic
1011112458 6:83853574-83853596 GAGAGTTGGAGGGGAGGAGCTGG - Intronic
1011374413 6:86674323-86674345 GAGATATCCAAGGAAGCAGCAGG + Intergenic
1011380805 6:86740360-86740382 AAGAGTCCCAGGGAAGCTGCTGG + Intergenic
1011857563 6:91713791-91713813 GAGTGGTGCGGGTAAGCAGCTGG - Intergenic
1012543960 6:100395509-100395531 GAGATTTGCAGTGAAGGGGCAGG + Intronic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1013826082 6:114213229-114213251 GAGAGGAGAAGAGAAGCAGCCGG - Intronic
1016904841 6:149138152-149138174 GAGCACTGCAGGGAGGCAGCAGG + Intergenic
1017870725 6:158484219-158484241 GGGTGGTGGAGGGAAGCAGCTGG - Intronic
1018294450 6:162330787-162330809 GAGTGTGTCAGTGAAGCAGCTGG - Intronic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019398542 7:836910-836932 GAGAGCTGGAGGGAAGGAGGTGG + Intronic
1019516509 7:1442554-1442576 GTGAGCTGCAGGGAGGCAGAGGG - Intronic
1019516555 7:1442690-1442712 GCGAGCTGCAGGGAGGCAGAGGG - Intronic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1019988866 7:4678677-4678699 GAGAGGTGCAGAGAAGCAGAGGG - Intergenic
1020832956 7:13113816-13113838 GAGACTGGCTGGGAAGCACCTGG + Intergenic
1022185024 7:27958860-27958882 GAGACAAGCAGGGAAGGAGCTGG + Intronic
1022602321 7:31773047-31773069 GAGGGGTGCACGGAAGGAGCTGG - Intronic
1022636169 7:32137798-32137820 GAGAATTGGAGGGAAGGAGGAGG - Intronic
1024213573 7:47227789-47227811 CAGAGTTGCAGTGGGGCAGCAGG - Intergenic
1024465059 7:49703516-49703538 AGGAATTGCAGGGAAACAGCTGG - Intergenic
1025995604 7:66525434-66525456 GATAGTTGCAGAGAGGCAGATGG + Intergenic
1026256121 7:68713374-68713396 GAGAGAGGCCGGGAAGCAGTCGG + Intergenic
1027546105 7:79529416-79529438 GAGAGGGGCAGGTAAGCAGCTGG + Intergenic
1028449045 7:90959537-90959559 GAGAATAGCAGGGAGGCAGGTGG + Intronic
1028708358 7:93876999-93877021 TAGACTTAGAGGGAAGCAGCTGG + Intronic
1031994381 7:128219754-128219776 AAGACTTGCTGGGAAGCAGGAGG - Intergenic
1032332827 7:130995914-130995936 GAGAGTTCCAGGTACCCAGCAGG - Intergenic
1032471526 7:132182497-132182519 AGGGGTTGCAGAGAAGCAGCTGG - Intronic
1033421682 7:141209686-141209708 GACAGAAGCAGGGAAGCTGCTGG + Intronic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1034557268 7:151858143-151858165 GAGCCTTGCTGGGTAGCAGCAGG - Intronic
1035749658 8:1987614-1987636 GAGAGGAGCAGGAGAGCAGCCGG - Intronic
1035749926 8:1990149-1990171 GACAGTTGCCGGGAAGATGCCGG + Intronic
1036219362 8:6908413-6908435 GAGAGTTCCAGGGAGCCAACGGG - Intergenic
1036648477 8:10626456-10626478 AAGAGCTGCAGGCATGCAGCAGG + Intronic
1036727341 8:11231604-11231626 GGGAGTTGCAGGAGAGCTGCAGG + Intergenic
1037935622 8:22913347-22913369 GGGAGGTGCAGGGAAGAGGCAGG - Intronic
1038328134 8:26587842-26587864 CAGAGTTTCTAGGAAGCAGCTGG + Intronic
1039352460 8:36778139-36778161 GAGATTTCCCTGGAAGCAGCTGG + Intergenic
1040313313 8:46247970-46247992 GAGGGTTGCAGGGACTCAGGAGG + Intergenic
1040324967 8:46337068-46337090 GAGGGTTGCAGGGACACAGGAGG + Intergenic
1040746020 8:50643437-50643459 GTGGTTTTCAGGGAAGCAGCTGG + Intronic
1041044211 8:53876745-53876767 CAGAGTAGCAGGGGAGCAGGCGG + Intronic
1041441794 8:57904964-57904986 GAGAGATGCAGGGCAGAAGCTGG + Intergenic
1041755771 8:61311679-61311701 GAGAATTTCAGAGGAGCAGCTGG - Intronic
1046723591 8:117650767-117650789 GAAAAATGCAGTGAAGCAGCAGG - Intergenic
1047409965 8:124616265-124616287 TGGATTTGCAGGGAAGCTGCTGG + Intronic
1047900864 8:129421097-129421119 GAGAGTTCCAGGGAAGGGCCGGG + Intergenic
1048005257 8:130414385-130414407 GAAAGGTGCAGAGAAGCAGAAGG + Intronic
1048170446 8:132101028-132101050 GAGAGGTTCAGGAAAGAAGCTGG + Intronic
1048507104 8:135031574-135031596 TAGCATTGAAGGGAAGCAGCAGG + Intergenic
1048950332 8:139491563-139491585 AAGAGATTCAGGGAAGAAGCAGG + Intergenic
1048954802 8:139526881-139526903 GGGAATTGCAGAGATGCAGCTGG - Intergenic
1049151387 8:141037534-141037556 GAGGGTGACAGGGAAGCGGCTGG + Intergenic
1049267834 8:141678735-141678757 GAGATTTGGAGGAAAGCAGAGGG + Intergenic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1050161584 9:2725107-2725129 GAGAAATGCAGGGAAGCTGAGGG + Intronic
1056257567 9:84815837-84815859 GAGAGTTTCAGGGGAGTACCAGG + Intronic
1056467547 9:86872771-86872793 GAAAGGTAAAGGGAAGCAGCTGG - Intergenic
1058600610 9:106665887-106665909 GGGTGTTCCAGGGAAGAAGCTGG - Intergenic
1058879886 9:109277159-109277181 AAGAGTTCCAGGGAAGAAGAGGG + Intronic
1059329729 9:113527234-113527256 GAGAGCTGCAGGGAAATAGGAGG - Intronic
1060544364 9:124451577-124451599 AAAAGTCGCAGGAAAGCAGCTGG - Intergenic
1061132161 9:128714264-128714286 GGGAGCTGCAGGGGGGCAGCAGG - Exonic
1061697783 9:132390447-132390469 GAGAGTGATATGGAAGCAGCTGG + Intronic
1061701922 9:132422623-132422645 GGGGGCTGCAGTGAAGCAGCAGG + Intronic
1061988887 9:134146868-134146890 GATGGTTGCAGTGAAGCAGCTGG + Intronic
1061997303 9:134193029-134193051 CAGAGCTGCAGCGAAGCTGCGGG + Intergenic
1062067570 9:134537057-134537079 GAGAGTGGCACGGGTGCAGCAGG + Intergenic
1062198645 9:135288689-135288711 GCGACTTGCAGGGCAGCTGCGGG - Intergenic
1062540429 9:137039574-137039596 GAGAGGTGCAGGGGACCAGGAGG + Exonic
1062724897 9:138066462-138066484 GAGAGAGGCAGGGAGGCAGGAGG + Intronic
1187423764 X:19159527-19159549 GAGAGTTGTGGGGAAGAGGCAGG + Intergenic
1187774773 X:22744078-22744100 AAGGGCTGCAGGGAAGCAGAAGG - Intergenic
1189964171 X:46354644-46354666 GAGGGCTGCAGGGAAGAAGAAGG + Intergenic
1192348675 X:70335894-70335916 CAGAGTTGCAGGGATGGAGAGGG - Intronic
1193684673 X:84562656-84562678 GATAGTGGCAGGGAAGGAACAGG - Intergenic
1194125083 X:90007383-90007405 GAGGTTTCTAGGGAAGCAGCAGG + Intergenic
1195315416 X:103672687-103672709 GAGGGTTGGATAGAAGCAGCAGG + Intergenic
1196996746 X:121391625-121391647 GAGTGATGCAGGCAAGCAGGTGG + Intergenic
1197346278 X:125327781-125327803 GAGAGCTGCAGAGGTGCAGCTGG + Intergenic
1199745877 X:150771688-150771710 GTGAGTGCCAGGGAAGCAGGAGG + Intronic
1201240744 Y:11954803-11954825 GAAAGAGGCAGGGAAGGAGCTGG - Intergenic