ID: 1121931847

View in Genome Browser
Species Human (GRCh38)
Location 14:97979295-97979317
Sequence GGGCATGCACACCAATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121931847_1121931852 26 Left 1121931847 14:97979295-97979317 CCCATGCATTGGTGTGCATGCCC No data
Right 1121931852 14:97979344-97979366 AAATGAAACACTTGAAATGCAGG No data
1121931847_1121931851 3 Left 1121931847 14:97979295-97979317 CCCATGCATTGGTGTGCATGCCC No data
Right 1121931851 14:97979321-97979343 ATTTAAAAGACATGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121931847 Original CRISPR GGGCATGCACACCAATGCAT GGG (reversed) Intergenic
No off target data available for this crispr