ID: 1121936855

View in Genome Browser
Species Human (GRCh38)
Location 14:98027815-98027837
Sequence GACCCTCAGAATCACCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121936855_1121936856 10 Left 1121936855 14:98027815-98027837 CCATCAGGGTGATTCTGAGGGTC No data
Right 1121936856 14:98027848-98027870 GATTTCTAGAGTTCCCAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121936855 Original CRISPR GACCCTCAGAATCACCCTGA TGG (reversed) Intergenic
No off target data available for this crispr