ID: 1121937110

View in Genome Browser
Species Human (GRCh38)
Location 14:98030004-98030026
Sequence ACAGCTACTCACCTCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121937105_1121937110 12 Left 1121937105 14:98029969-98029991 CCTTCTAAGCTTTGAGGCCATGC No data
Right 1121937110 14:98030004-98030026 ACAGCTACTCACCTCTACCATGG No data
1121937108_1121937110 -5 Left 1121937108 14:98029986-98030008 CCATGCAGGGCCTCTGTCACAGC No data
Right 1121937110 14:98030004-98030026 ACAGCTACTCACCTCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121937110 Original CRISPR ACAGCTACTCACCTCTACCA TGG Intergenic
No off target data available for this crispr